Mus_musculus Locus 5830418K08Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus 5830418K08Rik
Mus_musculus
5830418K08Rik
9
snoU2-30
7940..8236
18585
AGCTGCTTTTGTGCACACAGAAAGAACTGGGACAGCAGACTGGCCTCCCAGTGTTCCTC
CCTTCACCAGCTGGAAATATATTTTCTTCATTACCCTCTGCCTCAGCTGAATCAGGAAAC
TTTCAGACATCTTCAACAAAAAGTGATGCCACTGTTTCCTCAGACAATATGGACAGGCTT
TGGGATTCTTCACAACCCATCTCATCACAGCAAACTCATTTAGAATTTCTCCAAGAGCAG
TCCAGTGTTGAGACGGATAACCTTCAGGCTAGGCGGGAAGCCCAGGAGGTCTTGTTTGCA
CATACACAAAATACGCTGGAAAAAATTGTACGTTCTGAACAAGCTGGGTCTTCTTTGCCA
CATCAGGTAGCTCAGCAGTCATTTAGTTCACTAACATTGGCTGATACACAATCTAAAAAA
ATCCAGAAACAGCCTTTACCTGCAAACAAGAAAGGGCTACTCCCAAGCCAGTCTGAAGTC
TCAAAAGCTCAGGATGGATCTTCAGGTTTTCTACAGCAGACCCTACCTCTCCAGAACACT
TTAAAGTTGCTTCAAGAGCAGCTGACTAGACAGAGGAGTATGATTCCGCCTAGACGTGAT
GGTCAAGAGACATTACTTTTATATAAAGAAAGCTGTTCAGAAGACAGTGAGGCTGGGCCA
GTAGAATCACTCTCCTCCGTGGTTGTTCAGCATGCAGATGCTTCTCGTGCAGTTTCAGAA
GTACCTAAGCGGCTCCAGGACGTGTATTCATCTGAGGAAGAAAATAGAGTTCTCTCCAGT
CATTTGATCACCCATGGCTTTCCACAGCACAGCCTGCAAAGACAAGAACATTTTACACCA
CTCCAGGAAGAGACACACATTCAGAGGCTTATACTTGGTGCTAGAAAAAATAATGAGGAA
TTTGCTCCCAAGCAAAATGAATTAGAAAAGGGGCTCTGCTCTCAACAGACTGATGCCTTG
TCTTCTCCATCCCAAGTCACCGACTGGGGAACATCCCGGGGGTCTGTATCAGTCAGAAGT
GATAGGACAGACCCCTTAAGGCATTTTAAGATTCCAGCGTTTCGGGAAAGACTAGTTAGA
GTTTCACAACATACATTCCCTCTCCAAGATAATTTGCAGGAACACCAAGAATGGGTAGAC
ACAGAAAAAGAGAGCTTTCAATCTAGTCCTCTAACTCCAGAAAATCCATCTTCTCAACAG
ACAGGTTTTTCGTCCTTCAAAGCCTCATTAAGACTGCCATCGTGTGTGTCCTTGCCATCT
GCTGACTCTGGTATCACACAGCACCCTCTCTCAACAGAGAGTGACAGTAAAGTCAAGTCA
AGCCATCTTCAGATACCAGAACTGCAGCATAGACTTTCGAAGATATCCCAGCTCATCCCG
CCTCAACAAGACAGTTTGAAGGCCCTTCAAGAACAATTAGCTACACAAAGGGAAGCCATC
ATCCACTCTAGACAAGAAGCTCATGAAGAAACACTAAGAGAATGGAAGGAAAAAATATTC
CCAGAGCAGGTTGGTCCATTTTCTCCCCTGATACCACAACATTCACTTGCTTCATTCCCT
GTTTCTGATACTGAAAGAGCACAAGAACTGTGTTCAACCAACAGTGACACCATATCTTCA
GGTTATCCTGAGATGCTGGAGTTGCCTGACAGGACATTGGGTTTATCACATACTGCTTTA
CCTCAGCAGAATAATCTGACTGCACATCCAGAACACCTTCATGCACAAACAAATTTTTTT
CACTCTACTGAGAAAGCCCAAGAAGGGTTGGTGTTTCCCAGACCATGTCAATTTGAAGAG
ATGTCTGCTGAGCATTTTATCCAGCCTCAACATGATGACTTAAAGGCACTTCAACAGCAG
TTAGATATGCAAAGGGAAGCCATTAGATCTGGCCAGGAAATGCAAGAGAAAATGCTTTTG
CAAAGGTTAAATAAATTGGAGCAAAGGATATCTTCCAAACAAATTAGCTCCTCTCTATTT
TCATCCCAGGTAGCACTGCCCATTGCCAATTCTGACGGGACCTTACAGTCTTTCCCAACT
AAAAGTAACGAGACTGAGCTGCTTGGGTCCCAAGATGAGTATCTGAGCTTTTCACAGCCT
CGTCTGCCTCTGCAGAATAACATGACAGAGCAGTTGGACTTAGAAAAGGTATTTCATAAA
GAACTGCTTTTACACAAACAAAAGAGCCAAAACAAAAGTGAATCTTCTGAGCATTCCCTC
CCTCCTTTGTTTCTGTCCAAGGAAATAGAGCATCCATTCATTTCACTACCTTTTGCAGAA
AGTAAATCTAAAAGCATTTGTGAGTTGTATTTATCTGACAAGAAGCATGCAGCTCCTAAT
GATGCTGTGATCCCAAGATTGCAGGACAGGCTTTTAAGCTGTTCCCAACCTGTCTTAACT
CAGCAAGATAACATGAGTCTTCAGAAGCAGCTGAATCTACAAAGAGAAACTCTACACTCT
AGGCAAAAAGCCCAAGAAGAATTGCTTGTGCAGAGACAGACATCCTTACAGCAGCAAATC
CAAAGACACAGAGAGACTTTGAAAAATTTCTTTAATGTCAGTCAGGTATGTTCTGAATTT
AAAACTTTAGCATAATAGATATTTAAACCTGATTTCATTTTAATCCTAAACCTACTTTCT
CCTTAGTTATTGAGAGTAACTTAGTAATTGAGAAATTGAAACAAATATATCTACTTTATA
GAGTCATTTTTAAAATACAGTAAACATTAAAGAATATGCATCTTTAGGAATTTTGTTGCA
GTGGGTTCTCAGATAAAATTATAAAAAGGGCTGGTTAATAGATTTCTTATAGTGTGATAG
ATCCTGTTCTCTAACGACTGTTAACATTTGTATATGAATCAAAATCTGTGTCCTGTTTTT
CCCTAAGTGACATAATGGTATAGTTGGTATGGTTATAATCTGATAGAAGCCAGACCTACA
CTTCTTACATTTGAGTTGCTGAGAAAACTGGCATCGTCACTCGGACACATATTTAGTTAG
AATGGGTCTATTCTTCTTTAGGCCACTTCTTAACTTCCTTAGTGCAAACAATTCTGCAGC
GCCTAGATGTTCAGGAGGTACTTGAACCTAGAAGTTAAAACCCTAGAGTGATGAAGGGAA
AGTAATGGGGAAAAAAGGCAAAGGGAAGCACTCAGGTCTAACGTGTTAACAGGCGCAAAG
GAATCTAGTGCTTGGTGTGGGGCTGTAACGTACAAACTTTGCACTGGGAGTTTTACTCGT
TCAGTGATAAAAGTACGTCCCAGTTTTCATCTGTCAACATAAAGCAGATTGTTTATTCTG
AGCTATACCTGGGGATATGGGTTCAGGTTTCCCTAAATAGCTTGTTCAACAGTGGAAACA
GTTACAGGGACTTTGTAGTTACAGAGCAACAGAAAGTGATAAATATATGGTGCTTTCCAA
GTACTTGGTAGAGCCCATAAAGTAGGCTATTACAGAGACACGGGGCAAAACTGCTATAGT
GATGGAATTAGTCATTCAGCTGAGGTTCCGACTTAAGGGAGATTTCAATCTCATGGCTTA
TTCATGGGATCTCTTAACCCACATTCCCGTTTCCCTACCTATATTTTCAGGCAAGGAATC
CCACAGATGAGAATGACTTGGAAATGCAGAAGAGAGAACAGCTCGGAGGGTGGTTTCCTC
ACACCCAAGGCCTTACCTGGGGAGACGCAGGTCAGGGGAGCGCTAATGGTGAGCAGCCAC
GTGCAGATGTCCATGCTGAGCACAATGGTAAGATGATCCCTGTTATCTTCTGATTATACC
CTGTCCCTGCAGCTAGCTGACAGGAGAAAAGTCACAAAGTTTGATTTGCTTAACCTTTTC
TTGACTTGATAGGTGAGAGTCTGGCCAAAGAACTGAGTGGTAGAGCCTCAAAGCCACCTG
TCTCCAAAGTTAAATGTGTCTTGGACTTAAACCAGCATGAGCTTAGTACTATACAGGAAG
TAGAGTCACCAGCAAGTGGCAGGATTTCCATGCCAGGTAAACAAGGTGATAAAAATAGAT
CTTACCAGTTTGTTAGCTTTTTACTTTTTCTCGGTATGCTAAAATGTGTCCAAGAGGCAG
TCTTTGAGCACTTGTAGAAAGAGAAACCGGTTTACATAAAAATGACTAAAAATTGGGGGC
GGAGAGACGGCTTACCAAGTAAAAAGCATTTTCCTGTTCGCAGGTCTGACCGCTGGAGTT
AAGTCTCTGGATCCCGGGTAGAAATAGAGAACCAACTCCCAAAAGTTGTCCTCTGACCTC
TACATACACGCCATGCCATGGCACACAAACACCAACACTCTCACATATCATATAAATACA
CACAATAATAGATAAAATAGAATATACTGAAGTACTTAGCTTTTTGACTTAAATATAACA
CTGTAACTAGCTTTATTGTCTCACATGTGGAAGGCAGTGTGCACTGTAAGAAACTATGCA
CTGTGAGAACATATGGAGAAGGGCAGTTTGCTGTGTCAAGGTCTTTGCTGTCCCACATTC
TGACCCAGTGCTTTCTTTTATGTCCGATACTTGGAAACCCCTCAAGGTGGGACTTGATTC
TCTTTTCCCTTCCATCTATTCTCACCAGTCTTTTCCTGAATCTGCATGGAGCTTTTTTGT
TTTGTTTCTAGACAGGAACTTGACTATTTAGACCAGGCTGGCCTTGATCTTTTTCTTGTA
TCTTTTATAGGATAATTATGCCTAAAATGTTAGCTTTACTAGCAATTAGAACAGAATTCT
TTTTACCATACTACTTTTATGTTCAAACATCTAAAAAAAATTCCTCTCTGAAAATCTTGA
ATTTATTGACACCCTCTAGATTTTAGAGTCACCAGATAATTTTCTTGGTGAATTTACCAG
AGCATATCTTGTTTACAAGAAAATTAGCTTTTTTTTTTTTTTGATAAAAAAATAAGAATA
GGTAAAAATGCAATGTTAATATGAGCTCTTTGGGTCAAGCCATAAAATAAAGTGCCTTGG
TTTCTTACTGAAAGAATATGGGAAAGTGGGGAAACACAGGTCCTCTAAGAATCAGTACCT
TGCTTTTAGTAGGAAAGAACATATGTTTCATGAAATGACAATCGGAATGTTTTCACTAGC
TTTGGAAGCCTTTTCCCATGAAGGAAATTAATAGTTTACCTAATTTAGAATGATTGTGAG
GAAATTCCTTATCACTGATTCCTATAGTTAACTGAATCATGTTTGAGGTTATAAAAATGC
CATTTTGTCTAAAGGGAAAGTCACACCACTCCACTTCCTCTTTAAGGGTTGGTGTCCTGA
TCCAATAAATCACTGTTTCTTACCTCTTTGAACCCTTAAAACTGCCCACTTTCCATTCCC
ACTCAATCCTGACTGTCCTGGTTTGTTTTTTGTGTTTTGTTTTTCTTGGATGGCTGCAGT
AATTCCTGCCGTTTATTTTCTGGCTCTTTGAAGCAGAGTCTTGTGATGTAGCCCGTGATG
TCCTGGGGCTCACAGTGTAGCTCCGACTGTGCTCAAACGTGTGGTCCTTAATCTCAGCTT
TGCAAGTGTTGGAATTACAGATGTGTGTCTTGCTAAACGAGGTCATTCGTAACAATGGCT
TTTACCCCAACAAAATAACAACTGTTTGAGGGACAAGTGAAAACTTTGTAGTGATTTTTA
ATCCACAAACTACAGCTTGGTTGAAATTTCATATGGGTAGAGCAGGTAGAGGGGACACAG
GTTAATAATTAAGTTGAAAACACTAATCTCTATTGATTTTCCTTCTTTTCTCCCTTGTAG
CTCATTTCTTTTGTCTTTGTTTTCTGGATAATTTTCCTTTATTCTTTTATTTTACTGTTT
CTTTCTTTGCTTCTGAATGTATTGATTGCCTGATTAGAGTTAACAGTCTTTTTGGGGGGT
AGGGGGACTCCTCCAACACTCTACCTTGGTACATCCTTTTGTTCCATGAATACAGAATAG
GAGTGACTAAAAAGTTAGTTTTTGATTTGGTTCCTTTTTTCGGGGGGCGGGGGTTCGAGA
CAGGGTTTCTCTGGGTAGACCTGGCTGTCCTGGATCTCACTTTGTAGACCAGGCTGGCTT
CGACCTCAGAAATCTGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCATGCGCCAC
CACGCCCTGCTGGTTCCATATTTTCTATTGGTCCAAATTTTTCCCCATCATATATTTTAG
AAGCTTTCCTCTAAGTTCCTGCATATTTACTGTACTAAAAGACTGGCTGGATTTTTAAAA
CCTATGATCTATATGACCATTTTACATGATAAAGTGGCCATTTATGCACTAGAGAGAGAG
GTGGTTCAGAGGTTGAGCACTTAATTGCTCTTCCAGAGGACTCATGCACAGAACAATTTT
CATTCTAGCTCCATAGGATCCATTGCCCCTTCCAGCCTCCAAGGCACTCCACTTGTAGTG
TATATTCATACAGGCAGGCACCTAAAAGTGAATATATCTTAAAACAAATGGCCATTTTAG
CAACTGGAAATTTAATGAGCTGGGTTTTAAGTTTTTTTGTTTTTTGGTTTGTTTTTTTTC
CCCACCCAGGAAAAGCAGAGTTTTATCAAGACCGAGACCCATTAAGGGTCTCAGTAAGCA
GAGAACAAAGTTTCTTGGAGAGCCCACTGGCACATGATCCATTTGGTTGTCACCAACCAC
CTGCCCAAGAGAACAGCAAAAGCCATGACGACAATGCTGAAGCAGGTAAAAGATATGGAG
GAAGTGGAAGTGTTACAAAAGGTGACTACTGTTAGGTTATGTGTAATAGTGGTAAGTAGC
TTTGGTGACTGTCAGTAATAGATCATTGTGGTACCTAACTGCTCTCTTGATGTATGCAAG
CTAGGGCTGGGCTGCCCTGGATCTCACAGAGACCCTTCTGCCTCTGTCTTGCAAGTGCTA
GGAAATCTTTTTACTGCCAAACTGTCACCTGCAGTGAGTCCCATGATGGGGAGTATATGA
GGGATGATGAGTTGGCATCTTTGTAGGCCACATTGTGGATACAGTGGTAGGAAAGCTACC
TTCTAAAAGTTGTGGCACTGTAGAGAAGGGCCTAATGTAAGAAACTCATAAATATTATGA
AGAATTTTAAGTCAGTTATTCCACCAACCAGTGGCATCCAAAGTTTATTTTCTTGCTTTT
AAATAAATACATTTAGATACGCAGCTGTAATATTGTTTGCTGGCCTTCAGAGCAAAGCTC
CAATACCACTTTATTCACTGTAAGCTGCTTATTAAGTCATTAACTTTCAAAGATTTCTTT
TTATCTTAGCTTAATTTAAACACATATTGGTATATGAGTTGTAGTTAAAGCATAACATAG
GCCATGAGAGACTTTCTGTTGGAGGGTTGGTTCACAAGAGAGGAGTTGACTCCAGCACCT
GCTTTTTGTGTTATAGTTGGAACAACAGTATAGGACATTGTCAGTTTTGATATTTTGATA
TGTATTTTTGACTCTTCCAGCTTTATAATTAATTTTAAATATTTTAAAAGAACTTTTCCC
TTGACTAGCGTGACAACTACATTTTCTGTCTTTCTTTCTTCCTTCTTTTCTTAATGAGTA
TTCCCCTGGTGAGTAGTATAGATGACAATAAATGTTGCTATTTTTTTTCCCTTGACCTGA
GGTAAGGCAATTTTAAGAAGGAAAATAAAAAACTAAGGTATACAAATGCAGAGAATGACA
CCATCTGGTACTAAAATTTACTTTGTCTTAATTGCCCCTAATCCTACTTTGATCCCTCAA
ATTCACATTTTAGTTAAAGTCAAGAAATCTGATGTTGAGGATCATGCAGTATTGAGTCAT
GCTGTCTCAAAAGAAGAAGCGTGTACAAACCTGGGTCCACTTGGAAAGCCAGACGATGAG
GTTAGTCGTACTATTTGGTGTAATTTATTTAGCAGTTTGGTTTTATATTTGTTTAGTTCA
TTAAAAACTTAAAAGACTGTTCTCTGAGATCTACTGAAATAGATCAGTGATGAAAATAGC
CAAATCTGAGCATCAGAAGGCCTTTTGGTCTGGGGCATGATCTCTCTAGTTCTGAGAAGC
AAAACTACAAAGCGGTTTGTCTGTGGTGAGAGAAGGAAGAGTGGTGTATGGATGGATGGA
TGAGGGTGTGTACATATCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGT
CATCTCTGAGCAATGATGAAAAGGTTTTAGTACTGAATTTTGTCACTGTGAAGGCTCCTA
CACTTGACCTGAGCTCAGAATTGACAACTGGCAAATGTGGATGATTTGTGGTTTTTCTAG
ATGTGTCATGATCATGATCTAATATTTCCCTTTTACATTTTAGGCTGAAACACAAGAGAT
TTCTCAGGAGCCATTGTCTTCAGTAACTGTTTCTACTGGAAGCTTCTTAAGTTATGAAAT
CACAGATTTGAGCCTCACAGATCCAGGTACTATCAGACTTTGTGAACATGTTTAAGGAAC
TGCACTGGCTGGACTGCAGTGTGGTAGTGGAAGAAGCACTGCTTCTTAGTGTGTCCAAGG
GATTAGGTTTGGGGTAGAAACGTGTCGCGTACAAAGAAAAAAGCATCAGTGTCGAATAGA
ATATAGTACTGTGCAAAGTCAAGTGTGCATTCTGGCACATTTTCCCTCTTGGTTCCACCA
ATGTCAGCAATATATATTGCTATGACATATTATGTTTGTGATGAAGTACCCAGACATTAT
TAAATTACTGTATTATAAATGTTAATTAAATGTTTTCATTACATTCAATTTCAGAGTCAT
TTTCAGAACAGACAGAGCATCTAGAACAAGAATCTACCAATAAGCAGGAAGAGACTGATC
CTCTTAGTATTGCAGTCCCTTCAGTTATTTATCAGCAACAGCATTCCTTAGGTGCTCATA
ACTCTCTGTTGCCCATGGAGGAAGAAAGTACATCTGATCATACACATGTTCAGCAGATCA
TGGACAATGATGTAAATGAAGCAAATTTGATACCTGACAAAAGAGACTTTCAGGGTAAAA
TTATTTTAAAAGAATATTTGTATAACTTTTTCTAGCTTTTCATCTTTTTTTAGTTTTTAA
GTATTGTTTGAGCTTCATATTTCTTATGGCCTGCACATCATTTGTTCCAAAGATAATATT
GAGGGCATTTATGAGACAGAGTATCTGGGAGCACTGTCTAACTGAAAAATATAAAGGGAC
CAATGAGAAGATGTCTTGGCATTTGTCTTAACTAGGGTTTTACTTCTGTAAACAGACATC
ATGACCAAGGCAACTCTTATAAGGACAACATCTAATTGGGGCTGGCTTACAGGTTCAGAG
GTTCAGTCCATTATCATCAAGGCAGGAACATAGCAGCATCCAGGCAGGCATGGTGCAGGA
GGAGCTGAGAGCTCTGTGTCTTCATCTGAAGCCTGCTAACAGAATACTGGCTTCTAGGTA
GCTAAAATGAGGGTCGTCTTAAAGCCCACGAAAGCAAGTGACACACCTACTCCACTAGGG
CCACACCTTCTAAAAGTGCCACTCCCTGGGCTGGCCATCACAGCATTAAAGGCACTTGCT
ATCAACCCATGTCATAACTGACTGAGTTCAGTTCACAGAACCCACATTGGTGGAGGAGAG
AACTAACTTCTAGAGGTTACCTCTGACCTACGTATGAGCACTATGGCAGATGCACCATGT
CATGTACATGTGCATACACACGCATAAATGAATTAATTTAATTTTTTAATTAAAAGATTT
TTTTTGAAGAGCCTAAAGAGAAGGACAGCTCCCTTTACCTTTAATCACTACAACTAAGGC
AGGGATTTGGGTGGGATTTAGAGCATTTGCTCCTGTGGGACCATAGAGAAGTTAATTTAC
CTTTTTCATAAAAGAAGTTGAAATTAAATAAGATAGTATACATCAACAACAGCACATGGG
CCCCACAACAAGGAGGACACTGGTGATGAGTAAGATAAGTGAGAGCTCAGAGCTCTTACA
GCTCAGTTTCCCACGTAGTCTTATGTGGCCTGCCATTCTTAATTAACCATGGAAGCCTTT
TTCTATCTGGGGAACAGTAATGATTGGACTATGAATGCATCTTGTGAGCATGGAGAGCAA
ATGGAAGTAATCCTGCTGTATTAGAAATGTTTAACACTAATGAGCATGTTCTTAGCACTC
ATTTCCTGAGCTTCATTAAAGTTTTTAAAGTTAAACTTAGCTCTTTTTTTTTTTTTTTTG
CCCTTAAAGTTCCAGCTGTGGACCTTGACTTTCGAGAATTGGAACACATATTTCCACACT
TGCATCGTCAGCTCTTTAAACCCTTAGAACCACATCTAGATTTTGACTTATCATCCCCTG
GGACATCTCAAGAAGACAGCGACTTTTACCAGGTATATTAGGTTCAGTGCTGTGAGTGTT
GAGGACGAGTGATTAAAAGGTGGAGACCACAGTCATCTTGGTTTGGTGGAATTTGTAGAT
GAATGAGAGACTGCTTCGCTCCCTTCAGCCATGAGTGGCTCCTTGTACTCCTCAGTAAAG
GAGGTGTCCCACTTATCAGTCAGTGGGCTTATAAAAACCAGAGCAAGGAATTCAGTATCT
CACAGCAGTTACAGCATTCTGGAGTACAGGTTAATAGTTTGTCTTTCAGAAATTTAGGTC
AGTAGCTACTAAGAAGGGTACTTGGTTGAAAATGGAGTTCTTTAATCATCACAACTGTGA
CTGTAATGGTGAGGCTGTAATTAAAGAAATACAATATCAAAGGACTATGGTGGATTTGAC
TGGTAATATAAGATCAGTATTTCAGCCTTTTTTCTTTCTGTTCTCAGCAGAGCTCAGAAT
CTTCATCTGAAAAACATGTTAAGGCATTATCCACAGGCACAATCTGCTTCCCAGCACTGA
CAGCCAAGTCACATTCTCCTAACCCAAGGCTGAACCAACTTGATATTAACCTGGCTCATG
CAACAACTGAGGGTGTGTGACTAAGTGAGACCGCTAAATCAAGTGATGATTCTCTCCATC
TCTTTGGCATTTATCCCTCTCACCTCCTCATCTGTCCCCTCTCTGGTTCTCTGCATCAGA
GGTTCTGTTCCTTTATTTAAGCAATGTAATATATATTTGACTTGAATGTGTGCAGTACTC
TCACACAAATCAGAAATCCCTTTTGTCCCACCTGACTAACTGTAGTCATATCTTTCTAAA
CATTGTATGTGTACACACACACACACACACACGTTCTATTTTTGTTACTCAAAATTCTCA
TGGGAATAACAATGGAACTTAGACAATATTAGAGAATACATGCTTTTTGTGAAAATTACT
GACCACTGGGTTTATTGTATGTTTATACATATCAACTTTTCCTTCTAAAACTGTAGTTCA
TAAAACCTATTTACAGTTTACTTAAATTGTGACTCTCTATCCAGTGTTGACTTTGTGATT
TTTTTTTTTTAATGCAGGATCTGAACAGTCTTTTCAACAGCTTCGACCAGAATTCTCTTC
ACAGGAAAGCCAACATGCTGACCTACCCAGTATTTATAGCATTGAAGCAAGAGGTCCTTC
CCAACGCATGGAAAACCAGAACTATTCTGAAATGTTACAAAATAAGAAAAAAAGTCTCTC
TCTCCAGCCCTCAACAGAGGATTTGACTCCAGCTTGCAGTTCATCTGATACTGCTCTGTT
TGATCAGTTACACCTGCAGCACAGCACTCCGTGTGCTTCTGTCTCTAGTGAGTGCTCAGT
AAAACTGTTAGAAAGCAGAGAAGAAGTGCTGGGATTTGAAGAGCTGTCAAGAAGGGCAGT
TACAATGTCACAAAGACTCACTGAAGATGAAAATGTAGTTCTACCTATAAACCCACATGT
AGGAAGAGTGGAGAAGGAGGCTTCAGTTCAGGGGTCTAATCCATTGAGTATTCAAAATGA
AAAGCCAATTCAGAACTTCATTGAAACTGACACTACAGAAGCTGTAGGAAATGTATGTCA
GCTAGCACAAGCAGAGCACATATTAAAATCCTGTCCATTTCGGAGCCCTATTCCAATCTG
GGTAAGTTAATTCCTCTGCATTAAAAACTTCTAAGCAAATATGAAAAGCCTCACTTCAGA
CACTCATTTTCTATCAAATTTTGTTCAGAGGTTTAGGAGGCTGTACAGAGTCTGCTTATT
TCCAACTTTAGTCAACTACATGTGGTTTTCACTACTATTGTGACTGGAAGAATGCCAGCG
TTCACAAATAGTGGTATTTGATATTGAGTTATAGTGGTGGCTTTATATTAATAATGGCAG
TAATAAGCTGGGCAGTGGTGTCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAG
GCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGC
TACACAGAGAAACCCTGTCTTGAAACAAAAACAATAATAACAACAATAGTAATAATAATG
GCAGTAATAAAGTTAATATCCCCTAAAATAGATGATACACCAGCTAAATGTAAGGAGAAA
ATTGTCAGATCTACTGCTGTTCTTGCATGGGCTAAATTACCAGCTAGGAGTGGGTATAGA
GTTCATCCTGTTCCTGCTCCTACTAACGATGCTGGGAAAAGAAGGAATGAGGGAGGGAGA
AGTCAAAAACTTACAGTATTTATTCGTGGAAATGCTGTATTAGGGGCTGTATTTGGTATT
TGGTATTGAAACAAGCCAGTTTCCAAAGCCCCCAACCATTATTGGTATTACTATGAAGAG
AATTATACCAAATGTGTGGGTGGTTACAATGACATTATACATTTGGTCATCACCCATTAG
TGGGCCTCACTGTCCTAATCCAGCGTGGATTAGGATGCTTAGTGCTGGTCCCACTATTCC
TGCTCGGTATTGAATAGGACATAGAGAGTTCCAATATCTTTAGAGTTGGTTGAGTAAGCA
TTAGACTGTAAATCTAAACACAGAAATTAAGCCCTCTTTTTATCAAGCCTTAAGATGATA
ATCATGATGAATTGCAAATTTGAAGTTGTAGAGAAATTACTAAGGCTTCTCCCACCCCCT
TTCTGATAGGTAGGAGTAGATGGAAGCCAGAAGTAGGGTATTTAGCTGTTAATTACATTT
TCGTAGGTTTGATTCCTGCCAATCTAGTTAAGGTCTTAGCTTAATTAAAGTGATTGATTT
ACATTCAGTAGATGTAGGATATAGTCTTATCAGAAGTTAAACTTGTTCGTTTTCTTGGAC
TTCGATATCCTAAACTTCTACATGATTAGTTGGGATGAAAGGGGGAGGGCAACTGTACTT
ATAATTTTTAGGGAGGGAAAATAAAGTTGTGTTTGAAGTTTATGTGGTGGGTAATTATTT
TGGGGTTATTGTTGGTTGGAAAGATGGTAAGTAAAATTTAATAAATGAGACATATATAAA
AGAATAGATGTAACACTGCTATTGAGGCTATTAGCGTTCCTAGGATGAGGCAGTTATTTT
GTAGAAGTTCTGTGATGATACTTCATTTTGGGAGAAAGCCTAGAAGAGGGGGATGCCTCT
CCTAGGGATAGCAGAATTAAAGAGGTTGTTAATAGAATTATTGGTATTTTGTTTCATAGG
AATGAAATTGAGTTAATTGTTGTGGATGAAGGCTATAAGTGGAATAAATATTGGAACTGT
AAGGATAATATAAATAATTAAGTTAAGTTAGGGTGGGGTTGTAAATGAGGATGGCCATTA
TTCATCCTGTGTGGGTAATTGGTGAATATGCTATAATTTTTCACATTTGTGTATGCTTAA
GTCCACCTCATGTTCCTATGAGAATTGCTTGGTTAGTTTCTGCTAAGGTGGAAATAAGTC
TTATTATAGCTATGGCTCAGGCTGGTGTAATAAGTCATATGTGTTCTTGGGTGGCGATGA
GTATAGGAAAAATGAGCCGCTTATTAGGAGGATTGAAAGTAGAATAATGGCTATTGTTAT
TTCTTACGAGATTGTTTGGACTATAATTCGAAGGGCTCCAGGTAGGGAGTATTTTGAGTT
TGATGCTCATCCAGATCATGAGATGAAATATACTGAAAGGCTTGATGTTGCTAGAATAAA
TAAAATTCCTAGATTTAAATTGATTAGGGGTGTACTGTGGGTAATTGAATTCATAGACTT
AGGGCTAATGTCAATGACAGGGTTGGGGCAATAATAAATAATGATACTGAGGTCGTTAGG
GGGAGTATCAGTTCTTTTATGAAAAGTTTATTTTAAAGATTTATTTTTTATTTTATGTAT
ATGAGTACACTGTAGCTGTACAGATAGTTGTGAGCCATCATGTGGTTGCTGGGAATTGAA
CTCAGGACCTCTGCTCTGCTCTCTCTGGGCCAAAGATTTATTTATTGTTATATGTAAGTA
CATTGTAGCTGTCTTCAGATACTCCAGAAGAGGGCATCCGATCTCATTATGGATGGTTGT
GAGCCACCATGTTGTTTCTGGGATTTGAAATCAGGACCTTCAGAAGAGCAGTCAGTGCTC
TTAACTGCTGAGTCATCTCTCCAGCCCTTATGAAAAGTTTTATAGCATCTGCAGATGGTT
GGAGAATTCCAAAATGGCCCAACAATGTTGGGAACTTTTCGTAATTGTATATACTCTATG
ATTTTACATTCTAAAAGTAGAATGTAAAAATAGCAATTAGAATGGGGACTAGAAATGTTA
ATACATTAATAAAATGCATCTGAACTTCTGGGAACAAGCTTTTAAGTCTTACACAATTTC
CTGGCTCTGCCACCCTAATTACCTTGTCCAGGTAAATTATTGAACATATATAAATTTATT
TAAGAGCATTTATTATAAGGTAGCTCTATTTCTCGTATCCTTTTTACTGGGAGAAATTGT
AAATAGAAACCGACCTGAAACCTCCAGTCTGAACTCAGATCATGTAGGACTTCAATCGTT
GAACAAATGAGTCATTAATAGCTTCTGCACCATTGACAAGTCCAACATTGAGGTTGTAAA
CCCTAATTGTTGATATGAACTCTTGAATAGGATTGTGCTGTTGTCCCTAGGGTAACTTGG
TCTGTTGATCAAAAACACTTTTGGGTCAATAATAAGTTCATTTGAGTTGTAGGTCTATGT
TAAAATCTTTCAAAGGATTTGGCTCTCAGAGGTTACCCCATTCCAAATCTTTCAAAATTT
GATTGTGAACCATTAGGTTGATTTATTAATAATTAAACTAGTTGACTAATTCTCCATGGG
GTCTTCTTGTCTTATATTATTCCAGCCTCTTTACTGGAAGGTCAATTTCACTCATTGAAA
ATAAGAGACAATTGAACCCTCATTCTAGTCCCTAATTAAGGACTAAGTAATTATGTTACC
TTTGCACAGTCAGGATACTGCAGCAGTTTAACATTAGTCACTGGGTAGGCAATGCCTCTA
ATGGTTATATTTCTTTTAATCTTTCCTTAAAGCACCCCTGTGTTGGACTAATAGATTTGG
GTTAGGTAAATTAATTGGAGGAATAATTAATACCTATGGTCTGATAACTTCCAAGTTGTT
AACACATCTGTGCTAGAATTACTCATTACTCATATCAACAGTATTTCATCTATAAAATTA
ATAGGTTAACAGCTATCAACCAAACTTTTCACCCCTACCTAAAAATTTTGCTACATAAAT
TATCTTTTGGTTTTACGAGACAGGTTTTCTCTGTGTAGTCCTGTCTGTCCTGGAACTCAC
TCTGTAGCCCAGGCTGGCCTCGAACACAGAAATCTGCCTGCTTCTGCCTCCCGAGTGCTG
GGATCAAAGGCGTGCGCCACCATGCCCAGCTCCCTTATAAGATTTCTATGTCAGAAGTAT
CCAGTGACTTTGATGTTAGCCCACACTGTGATTATTCCAAGCACTTTCCAGCACGTTTCC
CCTCATAAATTAGCTATTGAAATTTATAATAAATTTGAGAAGGGTGATGTGTACTACATT
GCTTTCCCTAACAAAATACCACAGTATGGTATAGGCAAGTATTGTTCTGACTTCATGTGG
TGAGGGTGCCAAGTAGGTTAGCAGGCATATAGTTATCAGTATCTCCTAAGTGTAGAAAGG
CTACTAATTGAGATTGTATCTGCACCTGCCTATGGGATTGTTTTGAGCCTAATAAGAGAT
TCGTTCTACTAGGGCAGCCCCAATATATAGGATGGCTGAAAGATGTAATTATTTGTCCCT
ATGGAAGAACATATCCTATGAATGCAGTGGCATTAATGATCAGGGGTAGGGTAGTGTGAC
CTAAATCATTTTGTAGTGAACAACAAAAGTTGAGAACATCACTGTGGGCAATATTCATGG
TATGGCAATTCCTAGGTCAAATAGGAATAGCTACTAGGAAAAATTTTATTGAAAAGTCTG
CATTCATCTCTTTCCAAAATCTAATTGAAATGGACCTGCAAGCCCACCTTTAGGGGGACA
CCAGTAGTTACCCCAGGCTTTGCTAACCTAGCATCATGCAGGACAGTTCTTCTCTGTTAA
TCAGGAAACGGATACTGGCTATGGTATAATGGAAGAACCAGATCTCACTCTAGTGAGTAA
TAGTGACATCAGCATCACTGAAACAGATCTTGCAAACTTAACCCTTGAAGACAGAGAAGA
CAATGAAGCACAGTTTTTTCAGGTAAATGCCTTCACCAAAACTGCTAAAACAGGCTGTTC
TTGGGCCAAACAGCCAGACTTTAAATTTTAAAAGTAATAAAAATAAACATGAGACTGGGA
GGTGGGAGGAAAGCAAGATGCTAGCAAACTCAAAATGACTTTCTTGGAACTAGGCAGGTG
TCGTTCTGCCTACATCTTCAATGGAAACCTCTGTTTGTGGAGCTGTATCAGAGCCTTATG
TGGACCAACCCACAGTGGCACCTTCAGGTAAACCCCTTATCAGCTTGAGAACATTATCAA
CTCATGTTGGGATGAAAGCCACGCATAATTTTTCTCAAATATTATAGCTACATCAGGTAG
TTTACAAGAAGCATTTATGACAAGACAGACACTTACAGAACGATCTTACCAGAGGCAGAG
AGAGATCTGGAATAAAACTCGACTCCCTCAAACCAAAGTATCCAAAGAGAAGCTACCTAC
AGGTATGTAGGGCATTTTTTCTCTATTTGGTTTTTATGACTAAAGGGTGGTGTTTCCCTC
TTTGTGAGAAGGGCCACTTAAACTACTTCACTGAAAATGCTGTCAGCATCTAATGAGATA
TCTACTTCTATGGATTTCTGTATATTGAACCATCCAGGGATGAAGCCTACTTCATCTGCA
TTTGTATTGTTTGGCACAGTAGAGATTACAAAGACTTTAAGACTCATCCTTGAGCTTCCT
GCAGGGTGTGAATAAAGTGACTCTTCCTAAAGAGAAAAAAAGCTGTCTTCAGGGCACTAA
TTATTTTGCTAATATTACCAGCCTAATTCCACAAATTTCTCTTACAGGTTGCACAGGCAG
TTAGCTGGGGTGAAACAGCAAAGAGAATGAAAGCAAGAAAAAGGATGACCTTTCATTCAA
AGTACAAATTGAAATAAAACACTAGAAACTCCAGACCCAAAATACATACAAACTATAAAA
GGTTCTTTTTACTGTATATATTTATTTATTTTTAATTTAAGTCAAATAAATTATTTGAGG
GATTTGATTCCTTTGCTGTCCATCCAGGTCACCTGAAAGAGAAGACAATGAGAGATGTGT
TAATGAGTTAAGTGATTCAGGGTGTGTTAAGTGTATGTTAAGTGATTCAGGGTATGTTAT
CTTCTCAGAAAAACACAGCACTATCAAAACAGTGCAGGATTTTCTCTGTGAAGAACATCA
ATCTTTGGTCACAGCGTTAAGAGCTGTGGGTTTTATAGCCCAAAAAGCCCTCTTTGAAAT
GACCTTCATTGTATGTATATGGGAGCCCCTTCCATATACATACCTTCCTCAAATGTCCCA
GTCAGCCAGCCATCCACCCCATCCAGCCATCACCATGTTCCCAACAGCATATGAAGAACC
TCATGGGAATTTGTCTATGGTCATGTCCACAGCAAATGAGAAACTGCATTCTAGAAGCCT
TGGTAATGACCATTATAAAAATGACCCTTACTTGCCTTTCTTATCTGTCTTTGACAGCTT
CTAAGGGTTTGTGTGTGTGGTTTTTGTTTTGTTTTTAATTTTGAGACAGGGTTTCTCTGT
GTAGTCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAACC
CGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCCGGCAAC
TTATAAGGGTTTTTGTGTTTGTTTAATGAGACAGCGTTTCTCTGTGTAGTCCTGGCTGTC
CTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAACCCGCCTGCCTCTGCCT
CCTGAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCCGGCAACTTATAAGGGTTTTGT
GTTTGTTTAATGAGACAGCGTTTCTCTGTGTAGTCCTGGCTGTCCTGGAACTCACTCTGT
AGACCAGGCTGGCCTCGAACTCAGAAACCCGCCTGCCTCTGCCTCCTGAGTGCTGGGATT
AAAGGCGTGCGCCACCACTGCCCGGCAACTTATAAGGGTTTTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2564, 3590..3746, 3852..3995, 6549..6704, 7753..7859, 8323..8425, 10209..10351, 10790..10931, 11417..12000, 16444..16581, 16733..16826, 16907..17041, 17387..17585
1632..2564, 3590..3746, 3852..3995, 6549..6704, 7753..7859, 8323..8425, 10209..10351, 10790..10931, 11417..12000, 16444..16581, 16733..16826, 16907..17041, 17387..17400
BC118968.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved