Mus_musculus Locus Rg9mtd1
snOPY snoRNA Orthological Gene Database
Mus_musculus Rg9mtd1
Mus_musculus
Rg9mtd1
16
SNORA70
2894..3028
6054
CAGGGGTAGAGGAGTCGTCCCCGAGAGAAAAGAGTTTCCAGTTTTTATAGGCCCTCGGG
GGGAAAGGAGAAGGGGGAGATTAGGGGATTTCCAGATCTAAACAATATCTATTCTAAAAT
GATTGATTCCTCAAGAAATGGGTATGGGAGGGAAACAAGGAAAAAATCTAATGAAGGTAC
AGCAATGGGCACACACCTGGTCAGAACATTGGCAGGCACACAGGTTCGAGGAGTGGCCAA
AGCATTGTGCACCTCTATTTTTCTAAATCAATGAAGCCAGTTCTACTAACAATAAAATCT
ATTTTACCAATTTCAGGGCTTCTATGACCTTTTACATTCTGCCAGAATCTTTCACTCAAA
CTTAGTAGACTGTGCTAGCCTCAAACTCATAGAAATCCACTTGTCTCTGAGGACCAATAC
CCGGGGGTTGTCTCCTGTTCTCCACGTAAGTGACATGGTATGTACACACTGTAGTAGGTA
CTAGCAATAGTACTGATTTAGAATTAGATTTTATTTACTTTTACTTTCTTGGATTTTTCT
AGACAGGGTTTCTCTGAGTAAGCCTTGGCTGTCCTTGAACTCGTTCTGTAGACCACGATG
GCCTCGAACTTGCAGAGATCCGCCGCCTCAGCTTCCCAAACTCTGGGATTAAACACTGGC
CATTAGCCCGCCTAGAATTAAATTCTAAAATAGAACGTGAAGACTTGAGTCTTATGGTTT
TGTTATGACATGCGCGTAACGAGAGTGACCAAGTTGAGAGCCTGTAAGGATTCGAGTTCT
AACCGCCAAGCAATAAATGATGTGGCAGGGCATCGGTGGCGAGCCCCCAAATCGACTCAA
AACGTCATTTTCCGGGGGACTCAGGGGCAGTCGGCGAGGTCGCAGAGCGACTTTAGGCGC
GGTGGGGGTGGGGAAACAAACTGCCTGCCGAGTTAAACGTCAGAGGCCGTGGCCGGAGGG
GCGGGACATCCGGTGGTGCCGGACTTCCGGCGGCCGCGGCGGAAACCCTCGCGGTGCAGT
GCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGCCGCA
GTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGC
TTTCCAGGATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTG
CTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTC
TCCTGTGTCGCGCTTTAAAGTGTAAGTCGTCGGGGTCTGTCTCTCTGCCTAGGTGCTCCC
CATGCTTTCGATCTCTCCGGGCATCGCCATGCCCGCGCACATAATTACCCCCTTCGCAGA
CTCACACACAGAACTTTACTATAAAATATTTTTAAAATTTGGTTGTTATAGTGAGTGTGG
TGGGGCAGGACTCGGGAGGCAGAGGCAGGAGAATTGTCTGGAAGGGAATTTGCCAGCCGG
CGCTAAAGAGTGGAGAACCTATACTTTTGTTTTTGTTTTTAATTTCTATGGTGGTGTGAA
ATTTCTTTCTACTAGTTACAAAGGCAAAAATCAACTATATTGTTTTTATATTTTTTTTTT
AAGTAGGGTCTCATGGGCTGGAAGGCCTACAATAAGCCTTACCCAGGATGATAACTTTGT
CAAACTCAGGTCCTGAGGATTCTAAGTTAAATAATAATTCTCAAAGTCTGATATCAGTTT
TTATTTTTTGGTTGTTTTTGAATGGTTTTGCTGTTTTGCTTTTTGATACCGGTCTTACAG
TATTCCTGGCTGTCATGGAACTCAATATGTAGACTAAGCTGGCCACGTTTAACTGGATAG
GCACAGCCCTTATCCTAATGGAATATAGTCTTTAGTTTCTGGTGGGGAAAACAAGTATTA
TCATAGGCACAGGGTGCTCTGAAAAACTAATAGGATTGTTTGCTCTAAAGTGGGAAAAGA
AGATGTGCAGCTGAAAAGGCAGGCAAGCAAAGGGTGATACTGCAAAAACCCGCTTAAACC
ACATGAGTGAACTTGGATCTCAACGGAACACATAGTTAGGACTATACTGCTGTGGAATGG
AGTGCATCCGGGCATTTGCATGGAGCAGAGGACACGCACGGGTATACAGAGTCAGACAAG
AAGCTAAAGATGGGTGGGATTTTTCAAGAATTTTCCTTCTCCCTCACATTTTACATAAGT
TCTCAAACAAAGTGTTTTCGCTGTTTTGTGGAACATCTAGTTCTTTGAGATAAAACTATA
GAACCTTTTATATATTTGTCCTGGCTTTGTATATTTTATTTTATAACGTCTGCTATAAAG
TCTGAGCTGAGACATTTACTGTCTGTTTTAGTCAGCTGCCTTGCATTTCTGTTGTGGAAG
CGCAAAGGCATTTGTGGGCAGTGCTTTAGGGTTGTTTGTTTTTAAGTCAGGTTTCATCTT
CCGTAACTTTCCTGCTTTTTGTCTCCATTGTTGATTTCATAAAGGATCTTGAGATTGGAT
GTGCATCTGAAGGAGATTATAGTGTCTTGTTCTCAGCCCTATAATTGCCATATAACTTTG
CTGTGTTATTATATTGCTCATTTAGGCCCGTTCCATAACAAAGCTAAAAGAGGAATTTGA
GTCAACCTTTTGTTTAAGAATATGTTGAAATTACTATATAAAATCACGTGGAGCAGGAAG
TGGTGCTGCACAGCTATAGTGCCAGATCACTTAAATTGATGAGTTTGACACCAAGCATAA
CAAGACCCTTGTCTCACAAATTAAAAAAAAAAAAATTGACCAGTAAGTGATCGCAGCTTA
GCAGTTGACTTGGTGGTGTGCAATGTCTAAGATTTTCAAAGGTTTCCCGCTGAACTTCAG
AAATCAGTTGCCTTCTGCAGCCAATTAAGCCGACCAGGTTCCTTTCCTCATAGGAGTCTG
GTGTGCAATGGTTGCAAACAGCATCCTCCTTGCTAGTGTATGCAGCCTGCTGAATGTGCA
GGCTGCCCAAAGGGACCTTGGAGACAGTCTTCAGGTGCAGTCATGTGTCATTTCAATGCT
ATTTCAACCTAGGCTCTATACGAGTGTTTGGGGCCACGGTGACCAGTGGCACATTGATTG
GTTAGTCTCTCCATACCAATCTGCAGAGTAAGGAGCGTGTGACTGTGACTAAGGCCAACT
TCAGCTTTCCTGAGAGCCAGAAAATCTTCAGCCTAGAGAAATGGGGCTTCACCAAGTTTA
GTGCAGATAAATTTAAAGCCATGGTAGCTGAGAAGTGGCCTGTCCCTGGTGAGTGTAGGA
TCAGAATATCCCCAATTATGGCAGACCCAGTTTTCATAAAGGCTTCTGCTCCTGCTGAGC
TGAGGCCTATACCTCACCAATCATTCATTAGTAGCTCTCATATCCAGTCTGCCAGAGGGC
AGGGCGGGGTGACCAGTTTCATAGTTAAAAAAATTTTAAATCTTCAACTTAATTTTTTCT
TCTTTTACAGGGTTCCTCACATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACC
TTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGAGAAGTCATTTATATTCAGG
AGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAATAAGGACAG
TGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCAT
TCAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAG
AGAACTAATTGAGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGA
AGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTA
TCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGA
GGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCA
AGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGG
TGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACAT
GAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAG
AAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCA
TAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGA
AAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCC
CAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAA
AAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTG
CCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCA
GATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTT
TGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGT
TAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCG
CACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGGCTGAAAGT
ATGGTGACAAGAATGTAGTTATTCCTAAATGGAATTATCTCTTAAAGTCAGTCTCTCTAG
ACTAACAGTAGAGGTTTGCCTATTTTTTCTTCTTCTTTGCTTTTTTGCAACAGGATTTCC
ATGTAGCCTTGTCCTCCATCAAGGCCAGACTAGACGTATGTATCAGCAAAACTTTGAAAG
TATGTTTTATTTGTTGTAAAAACAATCAAGTTTATAATTAATCTAGAATTGAACACAATA
AAAGTTAATATTATTTATTTTTAATCGATTCTTTGAATATCAGACTTTATTGTCCATTTT
GGTTTGAGGGTTGATTTGGGTTGTTTTGTGAGTTTTGTTTTGGGGGAGGGAAGGCACGTC
TCCAGTAGCCTATGCCAGGTTCAACCCTAATTCTCCACTTCCACTTCCCAAATGATGGGA
GTACAGGCCTGAATCACCATGACTGGCTCCATTATACATACTCTTTATTTATCCATGTTA
GAAACTGTTCTTTCATGAGGAAATAGATTAAAGCTTTTAAAATTTGAAGCTCTAATTATG
AAATTAAAGCCTGTATATAACATTGGTTGTGTTCCAGGCACTAAGTTAAGGTATATTGCA
TTACATAATCTTGATTGTCCAAAAACTGGTTTTCCCTAGCATGTTAGGGGAAATCCTAAT
ACTATGAAAATTGAGTTTGGAGTAAATAAAAGCAATTTTTTAGGACAGAAAATGTGTCTG
GACCAGAATGATGTCTCAGTGGACTCTTGTAGAGAACTTAAATTCAGTTCCCAGCACCAC
TTTGGGTGGCTTGCAACCCCTGTAACTCTAGTTCTGGTGGGTCTGACACACTCTGGACTC
TAAGGGCACCTGTATGAAATGTGGTAAACACAGCTCATGCAGGCATATACACACATGAAT
ACAAAAGCTGACATTAATACCTGGTTAATACATAGTACTTATTGTATGGATAGCATTTCT
AGGAAATACTGTTTCTTCAGCCACATGGTTTTTAAATACGTCTTAGAAGTTATTGTTGTT
TGAATAAAGTGATGCCCACAGATAGGTCCTTGGGGATTGGCACTGTTAGGTATGGCCTTG
TTGGAATAGTTATGGCTTCCTTCCCTTAGAGGAAGTGCATCACTTCTAGGAGGTTGGCTT
TGAAGTTTCAGATCTCAGGCCATGCAAATGCGGCAGGCAGTCAGTCTATTTGTGGATCCA
GATGGAGAACTCTCAGCCCCTTCCCCAGCACTGTACCTGCCAACATCCTTCCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1280, 3490..5054
3511..4752
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved