Mus_musculus Locus Eif4a2
snOPY snoRNA Orthological Gene Database
Mus_musculus Eif4a2
Mus_musculus
Eif4a2
16
SNORA63, SNORA63, SNORA4
3625..3749, 4543..4671, 4859..4997
8188
GCCATGCAAGTTTATTACGAGCAATACGAACTATATTGTCTCAATTTCAGTAAGGCAAT
ATTAGATGATTAAAATCGTTTTTGTTTTTTGTTTTTGTTTTGTTTTACCAGAAGAGACAA
TCAGCTCTTGAAGTGCTAGGGCTGAGTCTGCCAGAAGCACCCATTTACATTTCTGTGTTA
CAAAGAATGACAGGTCCTTTGCACAAGTTGGTAGTGATTCTATCAGTCATTTCTCGCACC
TGTTAGGTTGAAATTATTAGCATTATTTTTTAAGCCAGAGCTGAAGACGACCGACCAGAA
AGAGATGAAAATCGAATCACCACCCTAGGGACATCTGTTAATGATACTACACACTGTGCT
TCTCGTCTTACAAAAATAGAACTGCAAACTGGATTTCCTAGGATGTGCTGGGTGGCCGAC
ATTTTCCGTGGCAGGGGTTTCACACGTTCCAGATCTGAATGGATATTAAATGGCTGGGCG
AAATGCCAGGTAGCCCTTTCCTGTCACATTAAACAGCAGTGAGAACGGGCGGGGTAACCC
TATTCTGTTCCGGCACGGAACGCGGTGGCTCGGACCAAGGGCACGCTGACGCGCAGGTAG
CCCGGAGCTGCGTCCTGGAGACGCCGCCCGCCAGCGAACAGCGCCACCGGCTTCCGCCCT
AAGCGCCCAGGGCTCCGCCGGCCTCTGCGGCAGGGCCGCGGAAACCCCGTAGGAGCAGGG
CGGCCGAGGAGCGCGGCGCGCGGTCGCGCTGCTGCAATATTCTTCCGCCGAAAGCAAAGA
GTCCCAGACCCGTTCCCGATTCGTGGATCTCCGGGAACGCTGTAATACCAAGTAATAGTG
AAATGTGGATTTTGTCATCGACTCCTGTAGGGCTTCACCTCCGGTAACAAACTCCAGGAG
TACAATTTTGTGGCTTCCGAAAGGGGAATAAGGAAATTCCTCCGCGAGAAACGGGTTCCG
GCCGCGAGCCTATAAAAAACGGGCGGCGCCGTCCGCCTGTCTTTTCAGTCGGGCGCTGAG
TGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGGTACGGCGCTCCCGGGG
CGGCCGGTGGCCTGTAGTCAAGGTCACTAGGACCCGCGTTGAGGTGGGTTGCTTGGCGGC
CACACTGCAGGTATGCGGGCTTTTTCTTAGGGCACACACTTCTCCTTGTGCCCTTCGAGA
AGCTTCCATGATGGTAAGACTCCAGATGTTGGGGAGACAGGACGGATACAAGAACGGAGT
ATTAAGGATGCCCTTTCTTAGGACACATTGTGACATCTTGGCTGCTGCCCCTCCCCGTAC
GGGATATGGCAAGCGGAGCCGTGGCGCAGACTGCTTAGGGGCGGGTAACCGGGACCCGAA
GGTTTATTGGCGGCCAGTGGCGCGAGCTGGCGTTCTTAGGGTTCTGTCGAGATGGGAGAT
TGGACGGCCAGGGGACGATCACCCTGGACCGTGAAACGGAGCGACGGAGCCGTTGGCATG
GACCTGCCTGGGCCTTTCGGCGTCAATCACGCCGGCTTGCGCAGAGTTAGGGGCGGAGCT
CGGCGCGCGGAGCACTCGCGAGAGCTTCGCTTCCCAAGCGGGAGGGCCTGGTCCTAGGGC
ACTGAGTAAAGGGGCGTCTATACTTAGGGGTCCAAGTCCCAAGCTGTTGGGGAGGGCGAA
TGGCGCTTCGCAGCATTGCGGCCGGTTTTGAGGCGTTTTCAGCAGAGCACAGGGGCGCGG
AGGGGAATGAGGTACGGGGTGGAAGGGCCCTTTAAGGGTCTCTGCGTGGCTTGGAAGCAG
TATGTCTAACTGCAGTGTTGTTGTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCC
CGATGGTGTCATCGAGGTAAGGAGTGGGTGTGGACGTTAAAGGTTTGGAAAGGTACATTT
TTTTTTCATGTCTTATTCATAGTTTCATTATTAACTTACAGAGCAACTGGAATGAAATTG
TTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATG
GTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGTAAAA
CTCTATTGCCGTTAGGATAAGTGCTCTGCACATACATGGACCGGAAAAGGGAAAGTGACC
TTTGGGGAAGTACTAGCACCTGATTGTATTCCTTAAAGTGAAATGATGGCAAATCATCTT
TCGGGACTGACCTGAAATGAAGAGAATACTCTTGCTGATCACTTATGTGGGCGTAACTTT
ATGTTCCAACTGGAATACATGGTGTATAGTAGAAGTAACGATTTGATGTGGGATCGGTAA
ATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGC
AAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACC
CAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTC
AAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAATT
AAAACGTATAAATTGTCCTAGTCCTGTGAGAGCCCCCATTTTAATTGTCCATGCATGCAG
GGAGTTTTGTTGAAAGCTAAGCAGGAAATGGGTATTGTAGGTATGACTTTAGGGATTGAT
TGCACCTCAACAGTTAAACCCATAGGTTTCTCAGGGTGGATTATATCTGTACCCATTTAA
AATTTGGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTAAACATTTGACTGTC
TCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCACTGCTATATTGGCTT
TGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAG
TGCCTTGTGGGAAAAAATACCAATATTTGCCCTTAAAAGCATTTCACTACACAGTGGAGA
ATGTAGAAATTGATTATTTACGTTCCTAGTTGGTGTTTGAGGTAACAAGGTCCCAAGTTT
AAAAAGAGGAGGGAGCATTAAGTTTAAGGTGAATTTTAAGCTTGAAATTAGTAAATTTTG
TGCTATGCATGCATAAAAGCTGTTGGCATATATAATAGTGCAATTATGCCTTTAAGCTTA
GTCTTAGACCTAGGTTTTATAGAATAACTACCATTTTTGGCTTTTAGATCCAAAAGGTAA
TTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATG
TTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAG
GGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTGTAAGTAGTGAATCTTAATGGTCC
TTCTTATCAAAAGGTTATGAGAACTTGGTGATGCAGTATGACTTTCTTATTAACAGCTCC
AAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAA
GGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTAAAGTTTATTTC
TTCTATTTATTTGGGGTTAGGTTTCATGCAGGTACAGTTACAATAAAACTGAAGTGTTCT
ATTGTCGTTCCCCCTGCTTAAAGCATTTGATACATTACTATCTCTGCCTAGCTCTACCAT
ACTAAGGCAGAGACGCTTGGTTTCAAACATTTTCCCGTCTAGCATTTGCTAAAAAGATTA
TACAAACTAAACAGATAAAGACAAGCATTTTATTTTTTAAAGGTTGTGTTGCTTTCTGCC
ACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATT
CTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAG
CGAGAGGTAATTTTGTTACAAGCTTTTTTTTTTTTTTCACCTTCTTGTATAAGCACTGTG
CTAAAATTGCAGGAACTAAGATTCTATCTTGGTTTTTGTAATAATGCTAGCAGAGTACAC
ACAAGAAGAAAAGTAACTGCACTGGATTGCAAAGACTGGGGTGGACCTCTTTCTTAATGT
CCAGTGTCCTATGTCATAAGATTCGGTGCAATAAGTATTTAGACCAGCAATAAATACTCA
GCTTGGAGATCATCATGATCTTTGTGGGTAGCATATCAGATACTACAGTCAACAGTTACG
AATAGCAACAAATTTATGGTGGGGAAACTATTAGAGGGCTGCAGCAATAGAATTGAGAAC
CACTGCTTTAGTTTTGTTTAAAATCATGGGAATTTTGTTTGATTTTAGGAGTGGAAGCTG
GACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAAT
ACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCT
GCTCTGGTAAGAGTTAGATTTAGTAATGCTAATTATAGCCATTAAGCAGGATTTAACTAC
AATATAGCTGCTCAGTGCTGTGTTGTCGTTCCCCCTGCTCAGAATAATTGTTTCTTAACT
ATACCTGTCTGCCATCTGCCTGTAGCAGCCAGGGACGCTTGGTCTCAAACATGATTGAAA
TTAAATGTATGCCTGAATAGTATGCCTGAATAGAGATTCTTGATTTGAGTTGTTTGCATT
TGCAGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAG
GGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGTGAGTCTGCTCCTGTGTATTTTAG
TACCAAAAGCTAGATTTGTGGGGAAGGTTTATTAAATAACCTTAACCAATTCAGGCTATT
TGGTAGAATAAGTAAGACCACACTCCACAGTGGGCTATACCACTTAGTATGGTTCATTAC
TATATTGTGGCCTACATTGGTTGCGGGGATGTCTAGCTTTTTGAATTAGGATATTGAACA
ACCTCTTTATTTCATTCAGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAA
CTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGTGAGAAGAAAGCATCTCCAA
TATTTGTATTGGAGAAGTAAATTCAAACACTTTTCTACGGTGTTTTGTATACAAGGTACT
GGCAACTCAGGGAATAGGTGGCAGTAAAAAGACAGTAATTTACTAAGGTCTATAGACATT
GTACTTGGGAAGATTGGTCAGAACAAAGTGGGAAAACTTGTAATGTGGCCAAGGTTGTGT
ACACACATGCAGATGAGGTTAGGTGCTTTAGACTACTTTTTGGTCTTAGCCTATGTTTTG
AGCCTTTTTAGTGAGTTTCTTGTGTCCATGTGCTTTTTTTCTTGGTGATTGATTCTATAC
AGTTGGGATTTTCTTGGTGTTGCTGGTAGCATTTTGACTGATTCCCTGGTTTAGTTATAG
TGGCTTTTATCCCTAAATAAATTGAATTGTACTTTGTTATATGATGTAAAAAAAGACTTT
TTAAAAAATACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGT
TGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGA
GTCGGTATTTATATTTGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAG
CCCAAGGCATTTTGTATGTTAGCATTTCTGATAGGGAGTGATAGGTGGTTTGTATTGTCT
GGTACTTTGTAGGAAGGTAGAGAGCTGTTTTGGAGGTAACACGTTTGAGTAATTTGAGTA
TATAACGTGTGAAAAGAAGCTGAGCAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAA
TACTTGCTTTCACACTGGAAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGCATTT
GTATTTACAGTTCCAGAAGTGCGTCGAAATGGATTGTATAACTGTTTTCTTTTATTCCTG
GTGTTTACATTTGTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTT
TAATTTCACCCCAAACACAATACTGTCATCTGCTTTATTGTAATGCTCAAGGCGCCTATC
TCATTTTGCAGCCAGACAAGCCTTGAATTCTTTTGGTGGCACTATCTGCAAAGGAAGATG
TTTTTCCACCTGGATATTGGTTTTATCAGCTAGTGCTCCACTTAAAAGCACGAACTATAA
TCCTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTA
AATAGTACTAAAGTAACTTGCTGACTGTTGGTTTCTTTCTCTTACACAGAATTGGCAGAG
GGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGA
TTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGG
CTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAA
TAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTC
ATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGA
GGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATG
GGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTA
TTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATA
AAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGA
CTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGG
TATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCT
AAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGC
ACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTTATATAGGTGGT
CTGGCCATTTATTTATAGTAACTGGTTTCATACAAAAGGGGAGAGATGAAGCCTCTAACA
GTTCTGAGTTAGCTGCTGCATCACAGTTGCACAAAGGCTCATCAACTGCAGGTGTTCATC
TGCACCATCTGCCAAGCACTTGTCTACTTCCTACAAAAGGAAATAAAAAAATTACCAAGA
CATACCAAAAAAAGTTTGTTGTTGTTGAAGTATAATGCTTACAGCTTACAGCAAGTTTCT
CTGTGATAATGGACTTGTGTTTATCAGACAGATTTTCATTTTCTATAATTGCATCATGAA
GTTGATTGACAAGCTGAGTAGCTGCATGTCCTTCATCTATGAGGTTCTGCAACAGAAAGT
TTAGGATTAGGAATGTTGCTAATCTATGATTTCTGTCATACCCAGAATAGTTTTTGTTAC
AGATTGCCCTGGCCTCTGCCTTGTTAAGTGCTGGGACTACCCAGTCAGTAGTGTAAGAGT
ATATTACCTTTACCACAGCTTCTAGTTTGTCAAAAGAGCCACTGTGACATGCAGTGAATA
TTCCATCAATGGTTGCAGCTGGTATTACCTGAAACAATAAGCATTAACAGTCAGGGCAAG
CTCTCTAGCTTGAAGGACTGTAAAAGCCTAAAGGGTTTACTGTACTTGCCCCAGCAATGT
CTGTGATCACATCTTCAGAGACTTCCTTTCCACCTGTTAGTCGAGTGGCACTCTGAAGAA
ATGTGATGGCTTTCCGTAAATCTCCTTCTGATATCTTAACAAGATACGCTATTTCCTGAA
GAGAGAATTTGCAAGAAAATTGGGCAGACACAATGATCCAGTTAAATTCCCAGAACCCAG
TGTGAGGAGCAAGACCTCTAACCTAATCATACTTGATTATAGAATTCACAATAATGCATG
TGTGGAGTCTTGTGCTTCACTGTTGCTCCCTTTTTTATTTTATGTATATGAGTACATTGT
AGCTGTCTTCAGACACCAGAAGAGGGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1830..1875, 1961..2093, 2362..2501, 3227..3395, 3476..3585, 3822..3965, 4368..4505, 4745..4834, 5059..5138, 5593..7188
1034..1062, 1830..1875, 1961..2093, 2362..2501, 3227..3395, 3476..3585, 3822..3965, 4368..4505, 4745..4834, 5059..5138, 5593..5599
NM_013506.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved