Mus_musculus Locus Ranbp1
snOPY snoRNA Orthological Gene Database
Mus_musculus Ranbp1
Mus_musculus
Ranbp1
16
SNORA77
8226..8351
10266
GGATGCACTGTCCCCAAGGGCCACACGCTGCGCCTGCCTTCGGCTGGCCAGCGCACACT
AGCTGCGTCTCCTCTCTCTAAGGGCTTGGTTCCGATGACGTCACCGCCGCGCGCCGAGTC
CCGACTGATCCTTCCAGCAGCCGCTCACGCCAGCGTCGGAGGCACTCAGCCTGCAGGCGG
AAGTGCGCGCGTGGGTCGCCGGGAGAGCGCGCTCCCCGGGCTGAGGCGCGGCCGGGCATG
CGCCGCGGGCGTTTTGGCGGGAAGCGCGGGGCGGGCCGGACAATGAATGTCCGCTGTCGG
AGCCAATAAAGCTACACTGGTTTTGAATCACTGCGCGTTTCCCGCCGCTGGGGTCAGGGG
TCAGGGTTCGGGTCGGGGGGCGGAGGGAAGAGCGGACGGGCGGGAGCGCCGGCGCCAGAC
GCGGAGGAAAGGAGCTGCGACTAGCCGCCCAGAGGCCGCCGAGCCAGCGACGCCTGAGCT
AGTCGAGCCACCGTCGCCGCGCCCCCATGGCGGCCGCCAAGGTACAGCGAGGCCCGGGTG
GGGCAGGGCAGCCGGAGAGGCAAGGGCCGCTATGGGCGGCCACGTGGGCGGCCCGCGCCT
CGGCCTCCAACCCTCGCTGGCTTGCGGGTTCGGGGCCTGTCGAGGCGCCTGGGCCTGGGG
TGCTCGAGGTCTTTGGGGGTCCGCGAGTGGGAGCTGCTGGCCAAGACTCCGATCTCGGGG
TCTACAGGGCGGCGCGTGACCTTGTGGTCTGCGGATGAACAGCCATGCCCAAACTGGGCT
CCCGGCTTCACCTGGGGACCTGGAGGTGGCCGATCTCCTCCGTCGTGGCCCACTTGTGAT
CTTCCCATTAGGGGCGGCAATCCTCCTTCCAGTTGCACGCAGACCCCTTCATTCATTAGG
ACATTGCGCCTTCGGTGGGGAAAGCTCGCGTCCCAGCGCAGGGTACAGATATTAGACGCG
CGGACTCTGGGCGGGGGCGGCTTTGTTGGTGGCTCGTGTGTCGGCCGCAGCTTAGCCGCA
GTGCTGAGAAACCGAACGAAAGGTTTCTGTTTCTTTATCCTGTTGAGTTAGGTAGTGAGT
CTGGGATTTCTCTATATTATCAAAGCACGTGATCTTGTCAGATTTAAACATGCATGTCCT
TGTAATTCTCCAAGTTGAGTCAGAATCTTAGAGCTTATTTGTCATACTTTTCCTAGCTTC
TTTCGGCTTAAAATTTCAAGCTTGGGTATTATTGCTGGAGGGATTGTAAACTAACAAGTG
CTTGGATAACCCTCAGTAAAAACTGTTACGGCTGCTCTTCCTTTTGAGTATATCATGTTC
TTTTTCATGGTGGGTATTTTTTTTTTTAACAGAAGAGGAAGTTTCTCCCAAGCTACTTTG
CCAAGGACTTGGGTGTGTGTAACCCATTGATGTTTGAGTGTGTAGGAGTGTCAAAATACA
CAGTCTTGTTTCATGATATCCTGTGATTTTTTTTTTTTTTTTTGTGATGCTGGTTGTAAA
TACAATCAGATGATGTGAAAGATAAAACCAAAGGCTTAATTTCCAATTTGGGGAGGCATT
TTCCAGATGCCATTTGTGATTGATGATGCCCATTGTGGACCGAGTCCACCAGCCAGCAAC
ATCACTCTACCTTCTCTACACAGGACAGTCACGAGGACCATGATACTTCCACAGAGAATG
CAGATGAGTCCAACCACGACCCCCAGTTCGAGCCAATAGTTTCTCTTCCCGAGCAAGAAA
TTAAAACGCTGGAGGAAGATGAAGAGGAACTTTTTAAGATGTAAGTCTGTTAAGGGGTCC
TGGAAGTATCTTTAGATAGGCTGACTGAGACAGAGAGAAAAAAGAGTGGACAGGAAGCAG
GTCTCTGCAGGCTATTTCTTTCACATTTTGCAGTACCCAGCAACCATAGTTGGACCACTT
ATGTTTACCTCTTCAATTTCTAGAGGAGCCAGCCAAGCTAGGAATTCTGTCCCTTGTATT
GTTTCTCTTTCAGGTATAAGCCTTAGTGATATGTTCTGGCATAGCCTCTTTGTGATTTCT
ATCTGGAACTGCACAGAAGAATTCTAGGGTGGCTGGGCACACTGATTTCTGTGAATTTCA
TGGCTTGGACCCAGCTTGATAAAGGCTGTTTTAAGAAAGTGCTTGGAGATGTATGGTGAC
TAGTCTTACAATGAAAATTCAACCATTTCTCAGCCAAAAATGTTGCCAGGTTATCCTGCT
GCCTTGTGGCCAGTCATGTGAAGGTTGTTCCCATCACTGTTCTGTGTCATCTGGGTGTCT
CCAGCAGGCTGTGGGGGCTCACACTTTTAGTCTCAGCACTTGGGAGGCAGAAGCAGGTAG
ATTTCTGTGGATTGTAGATCAATCTGGTCTATATAACCAAGTTCCAGGACTACATGGTGA
GACTTTTTTTGCTGGGTGGGGGCTCCCTTTCTTTGTTGAGCAGAGTCTTTGCTTTTCTTT
GTTTTTGCTTTGCTGTCTGTTGCCTTAACTGTATCCTCAAAGATTGAGGTTTGTTTAGCC
CTTGTTAATTGTTATGTGTGTATGGGCATTTTACCTACATTGATGTCTATCTACACAATG
TACTAAAGGAAGCCAGAAGAAGGTAGTGAATCCCTTGGGACTAAAGTAACAAGTTGTGAG
TATCCATTTGGACCTCTGGAAGAACAGCCAGTGCTCTTAACTGCAGAGCCAATTCTTCAG
CTTCCAGCTCATGGTTTTTCAGGTTAGAAAGTATGAGATCTGAGAGTGTAGTGCTAGCAG
TGGTATGGACCTCATTCTCATGTAAAATCAAGAGAATTTGCTAATGTCAAATTTTCAGTT
ATGCCTAAGATGTTTGTTAGAGGTTCTCTGCTCTGAAGGGAGGGAGGGAAGGAGGCTGCC
CATGGAGAGCCATAAGTACACCCTTGTACTACCTAGAAGATGGTGGTCCAGAGCTCTGAT
CCACAACAGTGGGTGAGGGTAGCATCTCCCTGAGTTACGTGGTACTTGATTTTGTCCACT
TGATGCTGAAAGTACCCCAGTGTCCTCGGTATTGTGCTAGAGACAGCATATTGTGCCTTT
ATATAAGGGCCTTTGAGCTTTCTCTTAAGGAGTTAAGTGAAGATGCAATCTCCCTGGACA
AGACTGAATTTGGAGGAGAGCAGAGGCTTTGTAACAGCAAATGCGGGCTACAGAGGAGAA
GGGTGCTGGCTTGGCAGGAGAGCCAGGTGTACTGGACTCATTGCAGGTACTGTGTACCTG
AAACCTGGAGGCTATAGGTTCCTTCTGACAGGAAGCTGTTGCTGGGCCTCTGGAAGATAA
TATTCCTAAGGCTTTATGTAGTTACAGGGCATTCATTTAGTGTGAGTAGGTTGTCCAGAC
AGACCTGTGGCTTCTTTACCTACTGAGGGTCATGTGTATCCTTAGATGTGTCTCTGGGGG
AAAATCCTTTGCTATGAATATCTTTCTGCAACCTGGTATTTGTTGGCCTATTGTGCTCCC
CTGGGTTTTATTTTGCCTAGTAATTCTTGGTGCCCAAAGCCCATTGAAGAAGGTTTTTGG
GGAAGACACAGTGTTCAACAGTTCCCTTATGTTCAGTGTCCAAAGAACACTTTGTGGCAA
TTGGTCCAGGTGTGAGTTCCCTCTCTGTTAGATGAAGAACACTTTGTGGCAATTAGTCCA
GGTGTGAGTTCCCTCTCTGTTAGATGTTTCCATACTGGCTTCTCTTACAGGCGTGCAAAG
CTGTTCCGGTTTGCTTCAGAGAATGACCTCCCAGAATGGAAGGAGCGAGGCACTGGAGAT
GTCAAGCTTCTGAAGCACAAGGAGAAAGGGACCATCCGCCTTCTTATGAGGAGGGACAAA
ACCTTGAAGATATGCGCCAACCACTATAGTAGGTGGCCTTTCAGTCTTTAGACCCTGCAA
GTTTTAGGAGTTGGTTACTGGGGGGGGGGGGCATATATTTATGACACTTATTGTCTTTTT
GTAACAAGTCTCTGAACTATGACAGTGAATTTAGGCTGTGGGCAAGATAGGTCCAGGGTA
GATATAGACCTCCAGGCTAGACTTATGTTATCTGGGCAAGTTGGAGCTATCCCGTGCCAA
AGCTGCCTTCTTTTTACTTTCTGTTATGTTCTCCTTCTAAGCTGTTTTCTGGGATGATAT
AGGAAGGAATCAGGCTGACAAGAAGGTAAATGAGGAGGGCTCTTGGCCAGGTGTGGTCTT
ATGTACCTAGAAAGAGGTCTCAAAGAGCCACCCCTCCCTATTTGTTTAGATCCATCTTGA
GCTGTGTAAAAGTACATGGATTTACACCCTCCTTTAAAGGCCTTGAAATAATGCACTATA
GCTGGGCAGTGTTGACATCTGTTCTAACAACTCAGTCACATGCCCTGTTACCTGCCATCA
AGTCTCACCCTGGCTACTCCTGCTCCATTGTGTTCTTTTGGCAATTCCTCATCCACTGTC
TCCACCCAGGACACCCTTACTGAGATCAGAAGTCCCACTTTAACTCTCTTCCTCAGCTAT
AGGCTGATCAACTCTTTATAACCAATCAGAAGTAAGGGAGAATAATTTTTATACATCATT
GAGATGGGAGATGCTTCAGTAATCATGACAATACTAACACCAGACTGTAATCAGATCTCT
GGGCACAGTGCACAAAACCATCCTCTACTCTTGATCCTGGTAGATTCTCTAATGCAAAAA
TCTACATTTTCTAAACTTGAAAAAAAATTTTTTTTCTTTCTTTTGGTGGGGATGGGGTCC
ATGTATAGACCAAAGAACAATTTTGTGGAATCTGTTCTTAACACTTTCACCTGAATTCTA
GAATCATACTAGATTGCTGAGCTTACATAGCTAGTGAGGTATCTGTCCAGGGCAGGTATC
TGTTCAAACTCTCATTTCTCCAGAGATAGTCTGGTTCAGATGGGCAGCAGAGGAAGGCAC
AGCGTCATGTTTGGAAAACAGCCCCGAAGGTTTTTAAGATTGATTGATTGATTGATTTAT
TTAGTGAGTACGCCGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCTAATCTCATTAT
GGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCA
GTCAATGCTCTTAACCACTGAGCCATCTCTCCAGCCCCATAGCTAGTGATTTTTATCTGC
TGAACACATTTTTTCTTTCCTTTGTGTGTGCATGCGCCATGGCCATAGCAGCCAGGTGGG
GGGGCTTGTAGGAGCCGGTTCTCCTCTCACCTTGTGGTTATAGGGATGGCAATGATGAGG
CCTGTAGAGTGCCTTTACTGAGACAGTCTACAGACTGCCTTTCTACAGGCTACACTTTCT
AGCCCATCAGGATCTTTTGTCCTGGTTACATAGGCAGATGATAGGTAAGATCAGGGTATA
GGACTTAGTAGGTGGTTTGCTGAGGCAGGGGCATGAGAGCGATCTTTGCCCTCCCTGTCA
CACAGTTGCCTCAGTCTCCTCTCAGTCCCAATTTGGAGCAGTCTCTGGGGTGGGGGGAAG
GAATCAAGTGCTCCCAAAGCCTGGCTAGCAAGCAGACCCTGCAGTCCTCCTGTCTCTCCT
CGTCTCATGCACCCCATAGGTTGTGGGTCAAAGTTGGCCATTGATTAGTCACTGTTCTGT
GGCTGTGATGAGACACCATGACCACAGATACTCATAAAAGGCATTTAATTGGTGTCTGGC
TTACAGTTTTAGAGGGTTAGTCCATTATCATCATGGAAGGAAGCAGATAGGCACGGTCCT
GGAGCTTTACATCCTGATCTATAGGCAGCAGTTGGAAAGAGACCCTGGGCCTGTGGCATC
AGCTTTTGAAATGCAGAGCCCACCCGAGTGACACTCTTCTTTCAACAAAGCCACACCTAC
TCCAACTAGGCTGCTCCTAATCCTTTCAAAAGGTTCTACCTAGAGCCAAGCAAGCCATTC
TGAGCCTCTGAAGGACATTCTCATTCAAACCACAGGCATCAAGTGAGGTATGGGGAAAGT
AAGACTGTGGATAGTGTACGGTTCCTAAGACCACTGTTAGGCTGGTGTAGCTCAGATCTC
TTGAGTTCCAACTTTAGCTGTCATGTGTGGTCAGAGGGCCTCTCTGAAATCCTAGAAATA
CTGCCAAGGGTACAGGGACCAGTGGCTGGGCATATATACCAGTAAGTGACATTCTAGAGG
ATCAGACTATCAGTGGAGGACAGCTATCTGTCAGTGCTTAGCTCTCCCTTGGTTCTGTAT
AGGACCTGAGGAATTCAGAATAAATATGTCTTGAGTCATGACTTATTTTCCATGACACAC
TCGTGTTTGTCATAGGATTCTGGTACCCATTGCTTGTGTTCTTCCTGGACTATAGCAGGC
TAAATAGTAATGTGGTGATTGCCCTGCTTTCAGCCTCTGTTCCCAGCTTTCAGTCAGCCA
GGTTCGTGCTGGTGTGGGCATGTGTTTGTAGCCATCTGTTGGTCACCCTAGGAAAGTTTG
AGCTGGAGTAGCTACCCTTAAAACGTCAGCAGACAGCCTGTGCTTCAGGGTCTTGAGCTT
GCTCCACATAAAGATTGTTCTGGTTTTAAGCAGATGTGGTTTGCGTCAGGTGTAGAGTTG
TGTAGGCCTGCATTTTAAAATTCCTCTCCGGGAGTGGAGTAGCTACATTTCTTTTAAGAT
TCTAATGACAAGTCAAGGTGTGATGCCACCAAACTGTATTCTGGGAACTAATGAGTTTAT
TGGACTTTCTTAAAGAACAAAGGTGAGGGGTTATTCATAGGGGTATTGGTGCTCCTTACC
CCATCAGGCTGTACTTGGAAAGCTTTGACTTAGCAGGGATGATGGCTCCTCAATAGGTAA
AGCCCCTCCCACTCCCTTAGTCTTTCCCAACCTAATTCTTTAGCCCCTCCTGGAGGAGAG
CACATGCAATTAGGGCAGAATTGCACACAACCAGTGATAGGATACTCAGGTGGGGTCTCT
GACCCCTTCTGAACTTGAGGGGATATAAACAGTCAAGCCCAGCTGGGATAATTTGCAAGT
GGGCATAGTAGAGTACTTCAGTATCATGGTTGCTTGGCTCAGGGTAGTCAGGTACAACAG
CCTGGATCTCAGATTTTAGACTCCATGTTGGCTGAAGTGGGTTCCTTCTCTTGGTGAGCA
GGTTGGTGCGGGCTGGGTGGTTTGGCCATTGTCCTCACAGGCTTCTCTACCCTAGTTACA
CCAATGATGGAGCTGAAGCCGAATGCTGGCAGTGACCGAGCCTGGGTCTGGAATACCCAC
GCCGACTTTGCTGACGAGTGCCCCAAGCCTGAGCTGCTCGCCATCCGCTTCCTAAATGCT
GAGAGTAAGCAGAACTTGCCCGCCCAACTGTGGGTCGCCTGCTGGGCAGCTGATGTTAGC
CCAAAGCATGCAGAGCCTCTGAAATTCTAGGGGTCTGTATAAACAGTTGTTGCATCCAGT
TGACTCCCATCAGGTGTGTGGAACCAGAGACACACCCTAGAGTTTCCTCCTGCTGCTGCT
TCTGCTTGGTTTCTGGTTCCTCAAGACTGGGACACTGGTGTCCCCTACGGACGCTTAGGC
ACCTGTACCAGCAAAGACTGCAGAGATCTGCAAGCCCTGGCTAATCTCTCTTCCATGGGG
GAATCTTTCTAGTCTGAATTGCCACAAAGCTGTGCCCTGGGGATCATGGAGAGTCAGCAG
GTACCATGGCAAATGCCCTAGTGGCTGGTACTCTTGTGAAAGTGAGCCTTGCCCTTGGAC
TTGGAATATAATGTGTATCTGGTAGCCCTTCCAACATGAGTAGAGCCTATAGTAAGAAGA
GCTTTGACCCTTGATTGTCTGATTGTGATAGACAGATAGCTGAGCAGAGTTGATGGCCTC
AGGAGGGACTCAACTGCAGTCATTAAATAGTCAGAAATTGTCACTGGGGTTGTGCATGGT
TAATCCCAGCGCTTAGGAAGCAGAGGAAGATGGACATCTTGAGTTCCAGGACAGCCAGGG
ATATGAAGCAGGATCCCATCTAGAAAAAAATGCCACTGAGGACCATGAATTGACTGACGC
TTCAGAATTTTAGGATATTGCCAGTCTACTTTGAGAACTTTCAGACATTAGTCCCTTCTC
TTTTTACAGATGCACAAAAGTTCAAAACAAAGTTTGAAGAATGCAGGAAAGAAATTGAAG
AGAGAGAAAAGAAAGGTGATGTGGTGCCCGGGAGTGATGAGGGTGGGTGGGTTGTGGGGC
TTCTTTGCAGATTCACTCTGCACCTGGCTGCAGCTCCAGTCTGGTGCTTTTTCCATCTGC
CAAAGAAACAGTCCAGAATGCTGTGGCTTCCTCTGCCTATCAGAGGCAGTGCAGCTGCCT
GGGGACACAGCCTGATGCCTTCCTTGTAGGCTTTGGCCTCACATCGGCCTCTTAGCATTT
GTGGTCAGTTTCAGGTACTGAGCTGAGTTACAGCTCTTTGGAACTCAACAGCAGTGAAAG
GGCTTTTAAGATATAGTCCTCGTGCCAGGTGTGGTGGCGCACACCTTTAATCCCAGCACT
CGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTT
CCAGGACAGCCAGGGCTGCACAGAGAAACCCTGTCTCGAAAAATGAAACAAACAAACAAA
CAAAAAGATAGATTTCTCATTTTCTCAACAAATTGTTTTCTGTTCTTCTGGGACAGATGG
GGCCTGGGTTAGTAAGTGACCACACATCACCAGCAGCTTGCTGGACCCATCTGGGGAGAG
TGGTGGGTGATGCTTGGGGAACAGGTCGGGCCTCTGCACTAGGTAAGTGCCAAGAGCAGT
GTAGTCTCACAGCCGGACTTCTCTGTTGTCTTACTGCAATTGCCTGTTTTTGCAGGACCA
GGCAAAAATGATAATGCCGAAAAGGTGGCCGAGAAGCTGGAAGCCCTTTCAGTGAGGGAG
GCCAGAGAGGAGGCTGAAGAGAAGTCTGAGGAGAAACAATGAATCACTCTGTCTTTTTCC
TTTCCTTTTCTTTTTAAAAATTTGCCCTACCCTTTAAGGTTTGTTTTTCTGTTTTGTTTT
TACAAGGGACTTTATAAAGAACTGAATTCCAATTTTCAGGTTGTTTTTTTGTTTTGTTTT
TTTTTTAACTTTTTTTTCCTCCAAGTTTTGACACCATTGAACATGACTTCAGAAATCCAT
TCCCCAGTCATGAAAATGTACTGTGCTAACTTTCTTTTCCATAGTGGAAACACTTATTTA
TAGTCATCAAAAATAGTGAATAAAAAATGCCTTTGAAAACCTGGACCAGCTGACAAGGCT
ATGTGAGGGGTGGGGAAGGTGTCTATGCCTGGAGCCCTCCTTGGCCACCTGTCTACCAGC
CTGATTTTCTCCTAGGAGAAAACCAGTTTGTCAAAATGGTGTGTCCTTCTGTGGCTCTTA
GGGACCAGATACTACGGTACCGGCTGGTGCTGGAGGCCACAGTGTGTGTGGCTGCAACTG
GCATTCAGGGCCAAGGTGGGCTGCTTCCTTGCTGCTAGAACTATTGCTTTGTGCTTTTGT
ATAGGGTCTGTGTGTGTGTGAGAGAGAAAGAGAGGTGAAGGGAGACTATTATGTGCTTTC
ATCTTGGTGAAGGGAGGTGGTAGGTAGCTAAACATCTGGCTATAGGAAAAACTGGTTTTG
ATTGGCTCTGGTTAATAGAGCAGCTCCAAGCTCAGTGGAGGGAAAGGCCACCATGGTACT
GTGCCATAGTGTAACTGAGTCTAGCCCTACACTCTCCTATTGGAAGCCATTAGGTGCCCC
AATACATCTTCAAATAGCACTCTAGGAGTTTGGACCTTGAATTCTAAACTCAGCACCATT
AGGATTAGGGACTACTTGAATAAAACCTGCCTTATGTGGGGCTAGAGAAATGGCTCATCA
GTTATGAACGCTTACTGCTTTTGTAGAGGATGAGTTCAGTTTTAAGCTCACAATTGCCTG
AAGCCCCAGAGAATTAGACACTCTCTTTCTAGGCAAATCAAATGATAATGCACATACTTA
CAGACAGGCAAAAGAAAGCCCTGACCTGACTGACTCATTGTGGGCTCAGGAGCTTCAGCA
GCCCCACCTCACAGGGCAAGACCCATGGTGGGGTCTGAGTGCATTAACAGGACCTGCTCT
TGCTTTGTAGCAGACTGCCAGTAACACCTACCAGAGTCTGGATATTTATCTGTTGATGCT
CGCCTTATTAAACTGACCCTGTTAAGTCTGACCTTGTCCTTTGCAGGGTGTGCTTACAAA
TGCCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1643..1779, 3710..3867, 7195..7323, 8109..8174, 8875..9266
1778..1779, 3710..3867, 7195..7323, 8109..8174, 8875..8978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved