Mus_musculus Locus Zbed3
snOPY snoRNA Orthological Gene Database
Mus_musculus Zbed3
Mus_musculus
Zbed3
13
SNORA68
8318..8449
14541
TGCCCATTGTTCATGTGACTTACTTTGACTAATAGAATGTGAGCAGAGCAGTATGTGGG
CTGAAGAGATGATTGGGGTGGGGGGGCGGGGAGTCGGTTACCGCCGATCCATCGCCCTCT
TCTGGATTCCACTGACACTGCACCCATGCATGCACAGACACCCACCACCACCACCACCAC
GCAAAAACACTAAATTAAAAAGCAACAAATTAGTGACTTTTGTTTTGTTTTTATGAATGA
AGGGCAGAACGTGCCAGCTGTGCGTTAAGAGCTAACTGGTGCGTTCTTGAATTTGGCAAG
TCACTTCCTTGCGACTATTTATAGATTAAAAATCTGTATGGTGGGAATATTTGAACGGCT
GGAACAGCAAAACGCTACACAACAGGATTGCCCGTCAGCCTGCAAAGCCCCAAGGCTCTC
GCCCGCACCTCAGCGGGCTGGTCTTGAAAAAGGTTTCTCTTTCCACCTGGAGCGTGGAAT
GCAGAAACCCGCCTTAGAACGCAGCCGCTAGCGGCTGATGTAACTGTAAATCACGCAGAC
GCTGTTAACTGAATATAATGAAGACAAAGGTAGTTCCCTGTGCTGGTGGTTTGGGTGGAC
ACCTTTTCCTCCTAAGACCTTGATTGCAAGGACTTCTGACTAGTGCCATATCAGAGGCCT
TAATCTGTAAGAATGCGAGCGAGCAGTGCGCCCAGCTGAGGATCTGGACCCGCTGAATCC
AAGGGCTTGGAAGGTTAACGCGCAAACGTGCAGAGCCACGGTTAAAACGCTTTCAGCATC
CCTGCGCTATTATTGCACCGTTTAAAAACCTCCGACAGATTTCAATTCGTTAAACTAGTT
CTCCATCCGTTACTCTAAACTCCTCCCGGACCGGATGGTTTAGCAGCGGCGCCCCGGCGT
CCAGACCACGCGTCACCGCCCCCCATGGACGCCCCGAGACGCGCAAATTGAGCGCTGTGT
CTTTAAGGGGGAATCGGCCTTTTCCGTCCAGGACAAAATGTCTGCGAGGAGCCCGGAGGC
GAGGGGCGACCATCGCGGCGTCCGGGTGAGCGTGGCTGGCTGGGGCTCGGTGGCGTGGCT
TGGCTTGGCGGGAGCGACCGCAGGGACACCAGGGGCTGCAGTGATCTCAGGGGCCCGCGG
GGACGTCCGGGATCGGAGAAACCGCGGGGTGGAGGGGTGCGGGGGACGCCACGCAGGACC
TCGGGGACTTCGGGAGCCCCTAGGCCGTGGGATCCAGGGTCGCAGCCGCGGGGTCTGCAG
GGGATGCCTACCACCCCAGGCTTGGCGGAGGGGCCCAGCCTGCGGGCTTCCGGAACCTTC
TGGAGCGTCTCCGCTCTCTTTGGTTAACCAGCTCCGGGGGGTGGGGGGTGGGGAAGAGGG
GGAACTGTCCCCGTAAAGTTGCCTCGGTGGAGAGTGACTTTGAGCCTCATGCGCTAATTG
CGACTTGGTTAATGTTTCCCACCTGTGTGTGTGTGTGGAGGGGGGGGGGGGGGCTGTAAG
AAAACCGGTGTAAACCAGAGTAAACCAGAATCTCCTCCTCCACTGGACACAAAAGAGTTT
CCTGATCCGGGCCTGGCTCACTGGAGCCTTTGGTTGTGCAAGCCTTCTGTGGCCGGCTTA
AAGCTTTACTAAAAAGAATAGGATTTTCCTTCATTGGAAAAAAAGTACCTGCCATTGCTG
AGCTCCAAAGGTGTTTAGAACAGCTGTTGAATAGTTTCGTGAGTTGAGATAATTAGTGGT
GTTCTGAATTTTTTATTTTATTTTTTTTTTTAAGACGGGGTCTGTTTCCTTGGGTGACCT
GAAACTTGCCTGTGTAGACCAGGCTGACCTGGATCTTACAGAGACTACCTGCCTCTGCCT
CCCAAGGGCTTGGATTAAATTCATGGGATTAAATTCCTGGTGATTCCAGTACTGTTTATT
AGTGCACACTTTGGCCTCAAATAGTTCAAGGCAAGTGACAATAAGAAGCATAGGAAATGT
TGTTTTTTAAAGTGCTAATCCATACCACATAATTCAAAAGCCACATGTGTGTGTATATGT
ATGTGTACATATACATATATATTAATGCAGAGCTGAAAGAAAGGTGCACTTTCGGGCATA
GTGCATTATTTTACAAGGCTTTAATAGTGCTTTGGTGGCTTTTAGCTAATGGTAGAAATA
GCTGAGAGTTCAGCTTACAGCATTCACGTGGCTTTTTTTGCTTCACTAAATAGCTATGAA
TCCAGTACTTTATTTTTTTTTAACAGCCCATGTAAAATCTTTTTCTGAATATTTTCCCAC
TTAGCTCTTTGCTTCACAATACGTTGCAATCATTTTCACTGACTTAAAAGTTTGTTATGG
GAATGCTCCCACCACCGTGTGCTCATGACCATGAGGATGCCTGAGGGTCCGATTCCACAG
AGCCTGGCTTACAGGCAGTTATTGGAGCAGCTGGACTGGGAGGCTCGGGGTGGAGCTCTG
CCCTCCGGAAGAGCGGTCAGCGCTCAGAACCACGGTCATCTCTCAGGCCCCTTCCCCAGC
TTTTAATTTCATGTTATGCCTTCAGGCTAATAATTACAGACGAATAGTCCTGGTTGTCTG
GGTCTGTTTATGAATGAGCCCAATGGCAGGAAACTGATAGGTGAGCAGAGCTGGGCAGAT
CACAGGTGAGTGGATTACAGCTCCTTGGCACTGCGGCTGTGGAGGGTAATTAATTACTCA
ATTATGTGTGCTTTGATTTAACCTCTGTTGGATGAAGTAATCGCAGGCCGTTAGTGTTTC
ACATAATCTGTGAATTTCAGTTTTTCCCGTTAGATCCAGGCTCAATCAACACACCCCTGT
TTATTGCTCTGCCTGGCAAATCCGGCTGAAGCGATCGGATCGGTCAAACGGGACTGCACC
TCAGTTGTTTCCTTTTGAAAACATTTCCTGGTTCTTTGGCCTCTGGCCTACCCAGTTCTT
ATGGGTGCAAGCATAAGCTTATGGGTGGTTTGTAAGTGACCTGTATGCGTGAAACGAAGC
AAGGGAGGTCTCAAAGGTGCGTGTCAAAGCACGGGGCTTTAGAGCTAATGGAAAATGGAG
CCGTGGTGCCCTTAGGGATGGTTGAGACGGCTTATGGTGGCTCTGAGGGAGAGCACAACC
AGAAGGCCCAAACTGAGGGGAGCCCTGAGAGGGGAAGAGAGAAGCAAGAGGAGCAAAGAG
CCAGGAGGGCCAGAGACTGAGTTCTAGAGATCAGACGCCGAGGCTGGGGGGAAGGGAAGC
CCAGCCCCTGGGCTGGAGGGTTTTGGTGAGGAGCCAGGACTCTAGCAGTGTTAGAAAGCT
GTTGGAGACTAGCCTCCGTGGTCTGCTTTGATATGTTAAATAGGCACCTCAGCCATCTGT
CCTGAGTTTGAGACAGAAAAGTTTTCTTCCTTTTTTTTTTTTTTTTCTCAATTTATTAGG
GCAGGAGCTTAGTGGTAGAGCACTTGCCTAGCCTGTGTGAGGTAGTTGGTGTAGTCTCCC
AACAGCACAATAAATAAATAAATAAATAAATAAATGCACACTTGCTTGTTTTATGATAAC
TTTATAGTTATACATGTATACATATCTAGCCATCCGTGTTAGTGTATAAGACCATAGTTG
CAGGTTTAAGGGTTTTGCATTTGTGTATGTGTGAGTGCCCATGTGTGTCCGGGTTAGGAC
AATCCTTACACCATGGGAGTCCCAGTGTTCAGACCTGCTGACAGCTGCTTTTACCTGCCG
AGCCATCTCGATGGCTCTATACATCCAGGTTTTAATGGCTTCCTTCAGCCTGTGTTTGGT
ATTTGGGGAAGTCGTACTGAGGTATCTGGGTTTAACTTGATAGGTTACTAGTAAGTTTCT
TCAAGATGGGTTCAAATGCAGGATGATCCATGGGACTCTGTTACCTCCCCAGGTCGATGC
AGGCTTATCACTCCTTCCAGAGAGTAGACCCCGATGAAGTTCAGCCACGGAAGATTGAGG
CCTAGTGCCACAGTGGTGGTCTCCCCTTGCCATGAAAGTTTGCAGTTTTTTCATCCAGCG
CTTTTGCCCTCTGAAATTGGACTCAAAATTGTTCACTACTAAGTTGACCTTTATCCTAGC
AGTACTTTAAGTAGCTTCAATGCGTTTAATTTTAAAAAAACGGGAACTCGGAAGCCTAGT
TCTATACTAACAAAGTAGAAGTTTTTGAAGCCAAACTGATCTGATTTTAACCAAGGATAT
CGGAATTATTACTGGAAATAGTTTCCTCCCTGCCCCCCTCCCCCAGGTGGTGAGTGTTTG
AAGGCAAAGTCTACACTGCTCTTCTCAGCTGGTCCGCAGCAGGCCCTTATGGATCCCGAG
CAGGTGCACAGTGGACGTTTATTTGGATGAGAGCTGGCTGGAGTAAAAACATAAGCAAAA
TAATCACACCTGTCGTTTAAAACCTTTGTGCCAGGTTTTAAAAAGCGTCTATGGAAAGGA
ATGAAAGGTCTTGTCCTTTGCTTTCTCTGTTAGCTACACGGATAGTAATGGTTATGCGTT
GTTATCTGGTGCGTATTAATGTGATTGAGCAGACCACTTCTATGTGAAGGTCCATTTAGG
AAGGGAAAAATCAGAGGAGCGATGGCTGTGGGCCTCTGATCCTTTCTCGGTTTGCTTTGG
GCATCATGAATCTCTTAGGATTCCATCTTGGATGTCTGCCAGAAATGCCCCAGTGCCGCT
CAGTGCTGGTGCACCTGAGCAGGAGGTGCCAGTCACTCCTCTGTCGTACAGCTGCTCAGT
GCTTCTCGGCAAGCCTTTAGGAACACGCTATCTTAGTTCTGGGAGATGTACCTATGGCAG
ATGCAGCCAGGTGTCTGCTCTCGCAGGCACAGGAACAGGTTGCACTCCTCCCTCTCCCGT
CACATCCTCTGCTTCCAGTGGGCACAGAATCTCCTGCTTGAGTAAGGCACAGGGGGGCAA
TGCCACACTTAGTGGACCCTATAGGTTCATGCCCTCCCTTCAGATGGCAACCCCCTGTGC
ATGTGGATCCCCCAAGTGTGTCAGCAAGGGCCTTGCCCTTGGGACTGTCTTCCTCCAGCC
TCCTTAAGGTCTGTTCCACCTGAACTCATAGCTGAGATGCCAAGGGTTGTTTATTAAAAG
TTGCTTTTTATTTACATCTAGATCTTGCCACACTGTGGTAAGGCCTAGGCATAGCACCCA
TATGCTTTCTTGGGTTTTCTTTGGCTTTTTTTTTTGTTTAATACTTTCCCTCCTCCACCT
CTCTCATCACCTTACAACTCAGCTGTTGTGTCTCCTTACTTTCTTAGCTGAATCTGTGAA
GATGACTCCATATAGGAGTTTTGGACACTATGCAAGTGATAGACATCCTGTAGAAGCTGT
ATTTTGAGGTTTTGCCATGTGGTCTGGCTAGCAGCACACAGGCATGGGCCGCTGGGCTCT
TGGGAGCCTTGTAGTCATGAGAGGAAATGGCTGATGCTCCGTAATGCACTGCAGTGCTCA
GCCATGGTGCTTGGTAGGCTAAGTGCATTAAAGCCAGCTTCTACTTACAGTGTCTTCCGT
GCCTGGTGGGTTCATTAGGATGTAACTACAGCATGACTAAAGAACATCTGTATCTTTACA
ACACTATAGAAAGCTGGCATTCCCTAGAAATGTATAAATGGGATTTTATACACACCTTAT
AACATCGCCCCCCCCCCCCAAAACAAAACAAAACAAAATACTTCTAGAACACCTGGCAGG
TTTCCTATCCTTTTAATGACTGCTTAATATTCCCTGTTGTAAACAGACATAATATGCTTA
GATATAAGTTCTCATTCTAAATAATGATGAAATCTCCTACCACATATGACTTAATGTAGT
GTACCTTTTAGTTCTACAGAATAAGTATCATACCTATTTTTAACTAATGTAGAAAGTTCC
AGATGGCGTTCCTCGAAGCGCTCAGATCTTTGGTAGGAAGCAAGTGTGCCCTGTTTCTGC
CCCCTTGGTTAGGGTGGTGGATGTAAAATGACACTTGCTCTTGCCCCCATAGCAGCTCCC
TGAGCAGGACCACCTTTACACAGACATTTGAGTTGGCCCTGAGGTCAGTGGCCTACCCAT
GTTTTTTTGCCTAGTTTTCTATTGGATCGCTTGCTTTTTAAAAATCCCGTTGTGAGAACT
CTTGGTGTGCTCTGATGTGCTGAGCAGTTCTGGAGCTAGATGGATGAACCTAGCCTTTCT
GCTGCACTCCAGGCAAAGCCGAAATGGGCTCAGGCTGTATTCCAGGGCTGGACAGGTGCA
TAGGTGGGGTTCCACCCTGATACAAAGTCGTATCCTAGGGAGCCAGGATGCAGCCTGCTA
TGGAGGACTGAGAAGGTGGAGCAGTTCTGTACCGTGCTGCCTTCCATTGGTTAAGACCTC
CAACAGTAAAGGGCTGGCCGGCCAAAGAATGTCCTCTCTATCACCGTGGAGGGGCAGCAC
TGAGCTGGCCCACATTGTAGTGTTGCTTGTCTCCCCCTCGGATGAGGAGCACGTTGAGGA
ACCCACGTTCTCCTGCAGTGACCGCCTTAACTTACAGCAGACCACACGGGTGGCTGGTGC
TCTTGGCATCCCAGAATTTACAGGAAGCCCGGTTTGCTGCAGCTCACAGGAGTATCGAAA
GCTTGACAGTGATGGGTCACCCCTGGCATTGTTAGAGGTGCATAAGCAGTGGGGACTCTG
AACCCTCCACACGGGTGAAAAAAATGGCAGGCTCATATGCCTGTCACAATGGTGAAGCAG
TAGTCAAATCATTTTAAATTGATGAAATAAAGTATAAAGATTCACTACAATAGCATCCCG
TCCTCTATGTCTAGTTAAAAAGAGCCCTGAAGGATAGATCGAGGCAGAAGGAAATGGAGT
TCTTAACAGATAGGGTATATAGAAAATCTTAGATAAAACTAGATAATCTGTTTCTAGTAT
AAAATCTTGGTCTATGTGCTCTTTAGAGTAACTGGTCAGCATGAGGAGACCTGGGTTTCA
CTGTGACATTTTCATACATAGCTGCATCTTCACAGGTTTTTCTCTTGCCCCCCCACACAC
ACACATCTTGCTAGTCTCCTTTGTCCCCTAAATGGTTCTACCTTCTGCTCCTATGCTGTA
TGTGTTCTGTTATCCTTTCTTGTCCCCTCCCTAGCCATTTAGACTCTTCTCTACTTTGTA
CATTGGTGTCCTACACAGATGCGTGCATCACGTATAAACTTTACTTTCTGTACGTGAGGG
GGAAGTGGCATTTGTCTTGATTCCGGCTTGTTCACTGCATCCAGCTCCCAGTTTCATCCA
CTTTCCTGCGATGTCCTACTTTCACTTGTCTGTATGGGTCCTCTACCACATCTTCAGCCA
GACCTGTAAGTCTGGTCATTTTTCACTGTGTCTGTAGGGTGTGTGTGTGTGCACATAAGT
ACCCCAGGAGCTGGCTGTCACACAGGATGGGTGCTGAGAACTGTGCTCCTAATTGCTAAG
TCATCCCTTCAGCTCCTGGTTCCATATCTTGACTATTATAGATAGTTCAGCAAGAAACAA
TGAGTGTGCAAACATTTCTGTGGCATGTGGACCTTGAGTTGTTCAGGTATACTCATGTAT
GATACAGAGGTCATACACTATTGATTTTCTGAGGAACGCACGCACACACACACACACACA
CACACACCCCGATGGGTATAACTACCTTAATTTAGGTTCCCACCAGCCTTAGAAAAGGAT
CCCTGTTTCTCCATGTGAAGACAAATGGCCACCAACAAACTATCATTTACTGGCCATTTG
CATCTCCAGCTTATTAATTGGACGCTTTTTGTCACTGTTTGGAGTTCGTTATGGATCCCA
GGTCTTCATCTCCCGTTGGATGTGTAACGGACAGAGGCTTTCTCTCATCCTGTAGGTGGT
CTCTCCTCACTGATGTGGGTTTGCCTGGCCATGCTGAAGCCTTTTAGCTTCCAGCATCAG
CTCTGACATCCCTTCCTGTGCAATTGACCTTTCTGCAGTCCCAGCTTAGACGTCTCTTAA
TGTTTTCTCTGGCAGCTTCAGGGTTCCCAGGATTCTACTAAGATCTTGGCTGTGCTGTGA
ATTGAGCTTGTGTGCACTGTGAGAGACTGTCCAGTTTCATTCTTCTGTATGTGGATATGC
AGTTTTCCTAGCACCACTTGTGAAAGAGGCTCTCTTTCAGTGTAACATGTCTGGAGCGTG
TGGGTTTGCTCGGTCAGTCCTCTATTCTGTCCACTGCTCTACAGACCTGTCTGCGGTACT
ACTGCGCTGTCTTGTTTCTATGGCTTTGTGGTATAGGCCAGTGCTTCCAGTATTGCTCTT
GTTTGCTTTGCGTTGAATTGACTGTGAAAGGGTCTCTTGTGGCACCCAACCCAAGAACTG
CCGCTGCCTGTAGCAGCTGTTTAAATAGTGGTGCACACAGCAAAGGGGCTTTATCGCCTT
TGGGGGGGCTGTGCAGTGCCCCCCAGAGTGAATCAGTAGGTTCTACAGTCCTGGGGAAAA
ACAAAACAAAGAGTCTTTTGTGTCCATATGCAAGTTGGGTGTGTTCTCTAGTTCTTGGAA
TTGGTTGCATTGACTCTGTAGATGACTTTTGGTGGCATAGCCATTCTCACTGCCTAAGCC
ATGACCACAGGCTCTACTTATCCTCCAGTGTCTACTTCAAATTTTTTCAATATTTTAGTT
TTTATATTAATAGGTCATTCACCTTAGGCTTTGGGGGTTTTGCTTTGTGTTTATTTTTGT
TTTGCTATTGAGAATGGGATTTTTTTTTTCCCTTGACTTTTTTCTTGGCAATTTTGTTAT
TAGTGTGTAGAAAAGCTGCTGATGTGGGGTACTAAGTTTGTTTCCTGTTACTTTCTGAAA
GTTGTTCTCTGGTGGCAGCCTAAGGGTCTTCTCAGGATCTGCAGATATGGATAATTTCAC
CACTCTCCCTGGTTGTACCCCATTCACCTCCCCTTCTCCCCACACTAGCTAAGACATTGA
GTACTCTACTGAACAAGAGCAGGGAGAATGAGCACCCTGTCATCTTTATCTTAGAGAAAA
TGCTTTCAGTTTTTCCCCAGTATGTATATAGCATTGGCTACTTTCTTGCCCATATATAGC
AAGAATGATTTAACATCAAAACTTTATGTATGTACACTTACATTTATTGACTTAAAGTCA
ACTACGTGATCATTTCAATAGGTAAAAGACCTTTGAGAGAATTCAATCTCTCTTCACCAC
AAAAGCCTTGAAGAAATGAGGGATAAATAGGACATAGCCTCAGAACCAATTGTGATCAGG
GATACTGGTCTATAATCTAGTTTCTTCCTTGTGTCCATATCCAGTTTTTGCATAGAGGTG
AAGCTTGCTTTGTGGAGAGTTTGGTAGTGTTGCCTGTTTTTTCTGTTTTATGGAATGGTT
TTGAGGCATGTCTGTATTAGCTTCTTTTAATTGTTCGGTAGAATTCAGCAGTGACCCCGC
CCTCCTTTGTTGTGAGACTTAATGCCATCGCTGTCACAGAGCTGTTTAAATTGTTCTTTT
TCCCTAGCCTTTCAGTTTGGTAGGTCATAAGCCGCTGGGAACCTATCCATTCCTCTAGAT
TTTACAGCACTTTGGAAAACGTTTTAAATATTTGCTCATCTCACAGGGTTGGTTAGCATC
TGATGCAACAGCCTTCAGTTCATCTCTAGTTTTATGAACCTGGATATTCTCTCGTTATTT
TGGTTAGATTGGCTAGAGGGTTTTCAGTTTTAAGGTTTTTTTCTCTTCAAAGAACTTGGT
TTTTTTTTTTAATATATATATATTACTCATCTAGCTAAATTTCACTAATTGCTGTCCCTG
TCATAACTTCTGCCATCTACTCCTTTGGTGTTTGACTTGTTCTTTCTGTTAGACCTGGGG
TACATCACTGGTCCATTGATTGTGACCTGTCTGGATTTTTAATGTGAGCGTGCAAAGCTA
TCAACTTTCCTCTTGGAGCGGCATAGGCTGCACCCCACAGGTTCTGGTGAGTTTTGCTTT
CATGTTCACTTGGTTCTAGGGATTTTTAAATTTCCTCCCTGAGTTTTTTCAAGCATCCAC
TGTTCTTTTTGAAAATGTGTGGTCTAATTTCTAAATGCCCGGGTAGTTTCTATAGTTTCT
CTTGCTGTTTTCTAGATGTGCTTCACTGTGATCTTTGATTCCTTTGTATTAAGGTTCCAT
GGGCTGCTGAAAAAAAAAAAACTTACAGCCCATGTCTTTTGGGTAGATATTCAGCATGTA
TCTATAATTTACAGTAATTTACTGAAATTACTTTAATACTTAGTTTGGACGATCTGTCTG
GACATAGGAAATGGGAATTGGAAGCACCCACTATTGTCATTTCTGGCCTTTTATGCCCAT
TACTTGTTTTAGAAAATTGGGAACCCGAATCTCTTCCTATGTACGTGCATATATGCGTAC
ACATCATGTACATGTACAGATGCTGTTTTTTTTCCTGGTCTTTGTCTTCAGTTTTTTGAT
TTACCAGATTCTGTAACTTTACAATCTCTCCCGCTCCTCCCTCGCCCTGCAGGATGAGCA
GTCGCTGAGTCGCTGCTCACTGCGCTTGGCTCTCCTTGGCCTGAATGCTTCCTGAGAGGC
ATCGGAAGAGTGCGAGTCTACGCATTCTGTTCTAACTCTCAAAGTTTGTCTAGATCCACA
CATCTGGTCCATTTCCAACTTGTTCTAATTTGTTCCAAACTCCACCTTTTTACAGTTTTT
CTTGCATGGAGGGGCAGGGTGTGGGTGAGTTGTCTTAGTCACTGAGCCAGTGTGATGGCT
CAGCAGGTAAAGCGCTCACCTCATGAGCCTGGTGACCCGAGTTCAATCCCCAGAACCCAA
GTCAAGATGGAGAACACCAATCCCACAGGCGGTTTGTCCGATCTCCACACGGATGCTATG
ATGCCTACGCACGTATTCAAGTCTCGGTGGTTACGGTCATGACACTGTTTGGGTCCCTCT
TGTGTAGATACTTTAGCAGACAAAGCATACACTGCTAGATTTCTTCCCCAGCACCGTAAC
TGGAAGTGTCAAACAGGCTTTCTATCTTATAAATATGAGAGGGGCCATTAGTTAGGAAAA
TAGTCTTTCTCATCCTGTGTGTTGGATACCTAGAAAATGCTCAGGAATAGAGGATCCTAG
ATGGAGATTCAGGAGTCACTTTCCTGCTAACCTAGGCTGTTCATGGCATTTCTTGTGGGT
CTTTGTGTCCTACAAACTCCAAGATCATCCTGAGTTATCCTGTACACATCTTTCTACTTT
GGAACCTAGGATTGTCCAGAACATCAAGCCAGTAACCAGGACCACCTCATTGAGAGACCT
GCCCTACCATCTAAAGGCACAAGCTTAAGGCTCGTTTCACATCTGCCTAGTTCCTAAAAT
GTGCATGCTTTGAAAGCTGATAGCTTCCTATATTGACAGTTTTCTTATGAATACATTGTT
ATAGTCGCCACTCCCAATATGTGGTGTTTGGAATCAAATCTTGTCACTTGTGTATGCTGG
GCGAGCATGCTACTGAGCCACATCTCCAGCGATTAGCTCAGTTTCTTGATAGGCGTGGTA
CGTGGAGATATTTTTTTGGAAGACAATGCTTAGTGCAAAAAGACTAGACATTTCTTTTTT
TTAGACTAGACATTTCTAACATTCTTCTTTTAGGCAATGACATTTAATGCTGAGTATTAA
GGAGGGGAAGAAACAGATCCACAAGGTTTGTAGCATAAAAGGTAGTTTGTCCTCGGCTAA
TGTTTATAGGATCTGTGTGTATAATGATTACTGTTATTCACCCCGCCTCCATGCAGACAC
TGCAGAAGGAATGAAGAGTAAAAAGCCCCTGAAGATCACCATGGAAGACAGCCGGAGGCT
TAATGACCCAGCGGAACAAGGCGGCCTCTGTCCCGCGCCCGTGGGGCCATCATACTCCGA
GGCCTGGGGCTACTTCCATCTGGACCCAGCTCAGCCTAGGCACCGGATGATGAGCGCCTG
GGCCACCTGCCGCCTGTGCGGGCTGCAAGTGGGTGGCCTCCCCAACTTCCAGATGTGGAC
GCGGGCGCTGTGCCAGCACCTGAGTGATGTGCACCTGCCGGAGCTGAAGAAGAGCGCTGC
TCCGAGCTCGCCGACCACCATGCCCTGCCCGCCGCCGCCCAGCCCCACCATGGCTGCCGA
GGGCGACTGGGCACGCCTGTTGGAGCAGATGGGTGAGCTGGCCATGCGGGGCAGCCAGCG
GGAGCTGGAGCTGGAGCGGCGCGAGGCGGCCCTAATGCAGGCGGAACTCGAGCTGGAGCG
CAAGCGCCAGGCTCTGAAGCAGGAGGCACAATCCGTGGAGCAGGAGCGCCACCAGCTACA
GGTAGAGCGTGAAGCACTGAGTAAGTGGATAAAGAAGCAGAGCCCCGGTGCACAGGTCCC
GGAACCGCCCTCTCCCCTGCCTCTGCTCCCCAAGGAGGACCCTGACATCCATGACAACAA
CAGTGACAATGATATGGTCACCAAGGTCCTGCTGTAGCATGACTGACCGCTCCATGTGTA
AACCTAACCATAGGCTGCAGGCGCGGCAGCGCCCCCAAGTCCAGTAGCCTGGATTAGGTA
CACAGACAGGATAGTCCTCACAGCTACCTCTTTGTAGTCCTGAAGGCATTTTAAGCCAGA
AGGTTCTCTAAACACCAGAGACTCATCACACCGCGAGCCTTTTGTGGGGAAGGGGCATGG
TTTTTATCCAGGAACCTGGTCCACTCTTTTCCAAATGTATAATCTTGACTTGGCACCACC
ATGTTCCAGAAAGGAACCTTGAGTATCACTGACTCCCTGGCTCCCTGCCTTCAGCATCTA
TAGAACCCCACCTTGGACCAGTCCCAAAGAGACCCCTTTTTGTTCCTGTCCCTCATGTGG
CTAACCCAAGGCAGTGAGCACCCTTAAATCATCTTTGCCTGGATGAGACCCAGCGACAAG
TACATTCTCCCATTTTCTTGTCTTGCATCTTGCCACCTTACTAGCAAGACATCGGCCACT
AGGGAGAAGTTTCTTGCCCCACAGGTCCCCACAGACCTCCCCCTGAACCAAAAGAAAAAC
CAGAGGCCGCGCCTCCCCACTGCCTTAGAGTCAACCCCTATCTCATTCCCTCCCTTTCTT
CAGCCCGCTCCTCCCGCCCCCCCCCCATGCCTCCTATCCCAGAAAGTCAAGATGTCCTCG
TTGCCCACACTTGCCACTTTGCATCTCACCATGTTTGTTTCATGTCCTGCGCATGCTAAG
CTAGCACCCAGAAGCCACACATGGCTTCCCCAGCCCTGACCTGCCTTCTGAAGCCCCTTC
TTTTGGAGGTGCACTGTGCCTTTCTAAAGGCTTTTGTTTTGAGGTAGGGTCTTTTTAAGG
TAGATTAAACGTAAATGCCTTTTTTATGAGACGTTTGAAAGGGCAATCTGACCATTATAT
TTTATAAAAACCACATACATTCTAGGACAAATCACTGCATTTGATTTGGGAAAAATGTTT
CTATGACCGACGTGAAATATAACCCTGACAGATTAATTTCATGAAATACTTGTAGTTTTG
CAACACTCCTTTTTTTTTTTTAATAAACTTTTATTTATCTGCATCGGTGTTCTGCTTGCA
TGTATGTCTGTGTGGGTGTCGGACTTGGGAGCTACAGACAATTGTGAGCTGCCATGTAGG
TGCTGGGAATTGAACCTGGGTCCTCTAAGAAGCAGCAGTCAGTGCTCCTAACTGCTGAGC
TATCATCTTTTCAGCCCCGTTTTTGTTTCGGGGTTTTCTTGGTTTTGGTCTCTGAAGCTT
CCATTTTCCTGAGTTTGAAAATTAGTCCTCTTTGCACTTGAGCATAGGAAAGCAAGTAAG
GGAAGGTAACATCTAAGCACAGACAGGAAAATAGGCGAGTGAGTCACCTTTAACAGTGGT
CCGGAAGCTTGGCCATTTGAAGAGTAAATGGTGAGTCTTTATATTGTTGGTGAGAGAAGG
TTTTTCTATCCTGGAACTCGCAGTGCAGGCCAAACTGGCCTTAAACTCAGATCTGCTTCA
GCCGTGGTTGCTGAGACTAAAGGTATGAACCAAGCTCCCAAACTGTTTTTACTCGGAAAA
CTGTCAAACTTTTTTTTTTACCTTGAACAATCTAGGAAGTTATATACATATACACCCGTA
TACATATGGATAGACATGGCAGTTTCTGAGCATCCACTTGTATTTTAGATTTGTTTGTTT
GAGCTACCTTCTACATTTGGCACCTGGTTCCTTTCCTTTAGAGTTTCAGTGACTTCTGCC
AGCTACTCGCAGATCCCAGCCTTCACTCTTCACCCTGGGTCTGGACTTCATGCCCTGTTG
CCTGCTTTATGGCTCCTCCCACCACACATCTGCCACCGCTGACTCCTGATAACTAGTATT
TTTCTGGGCACTTGCAGCATTATCAAAGATGCAGCAGCTCCAAGGTGAGGTATCAATATT
GTGCTTGCTTTATAAACCTTGTCATTGAGGTGTCTTATTAGGTGAAGGTGCTTGCTGCCA
AGCATGAAGACCCGAGTCCAGTCAAGATCCTACCCACCTGGTGGAAGGAAAGAAGCAACC
CCACAGCTTCTGACTTCCATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1044, 11756..13541
11770..12453
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved