Mus_musculus Locus Cks2
snOPY snoRNA Orthological Gene Database
Mus_musculus Cks2
Mus_musculus
Cks2
13
SNORA2
3875..4010
7330
TCGCTGAGTTTGAGGCCAGCTTGGTGTACAGAGCGAGTTCCAGGATAGCCAGGGCTACA
CAGAGAAACTCTGTCTCAAAAACAAAACAAAACAAAACAAAACAAAAAACAGCCGGGCGG
TGGTGGCGCACGCCTTTAATCCCAGCATTTGGGAGGCAGAGGCAAATGGATTTCTGAGTT
CGAGGCCAGCCTGGTTTACAGAGTGAGTTCCAGGACAGCCAGAGCTACACAGGAAAAGCC
AGTCTCCGAAAAAACAAAAACCAAACCAAACTAAAAAAAAAAAAGGAGGAGGGAGGGGTG
TTGACCTGGCATTGGAGTACAGGGATTAAAGGTGTGGGCCAGTACGCCCAGCTGCCGTGG
GTTACTTTGTTATCCTAACAGCCACACCAGAGCAATTCATCCACTGCAACAAATCGCAAA
AATATTAAAAGAAAAATGACACCTGCTCATTGTAGAAAATGGTTGTTATATGTAACTTGC
TGCACGAAACCACGACTTAACACCCTTTCAACTTCCTTTTACATGAGCACATCTTTTTAA
GATGGGACTAGCTCGCAGCCAAGCGTAATTAGCGTTGCCATCAGGGGCAGCGGAGGGCAC
CTTACCCTCTGGAACGCTCCGCAGCTGGACTTCCCTGACCACAGAGACCGCCCCCCAGGC
GTCTCGTGCCGCTCCGGCCCCCAGAGCCCCGGATACCTCATCTCGTGTCCGCCCACCACC
CAACGGTTCTGCCCCCAGGCACGTTCTAAACCACTGCGCACGCGCTGCGAGGCACTTAAC
GACTCGGCTCCGCCCTTCTCAATATCTCTTGGGGTCGCCGGGCGCTCCTCGCTGAATCGT
TAGCCAATCCTTACTCCCGCCCTCGCAATCTTGCAACAGGCTTCTGATTGGTTACCTGTC
CTCGAGGTCTGCGCGGAGCGTGATTGGTTGGTGGCTTCGCCCAATCGGCGGAGGGCTGTC
GGATTCAAATCCAGAGCGTTGGGCCTGCGGTCGTTGGCCTCATTCGAGTCGTTGCGTCGG
CCCTAGGCGGACGTAGAGCCCCTTGCGCCCGGTTTCCTGATCCCGCTTACTCCTCTGCGC
GCCGGCAGGATGGCCCACAAGCAGATCTACTACTCAGACAAGTACTTCGATGAGCACTAC
GAGTACCGGTGAGGAGCGCCTGCGGAGGAGGGCCGCGCTGGGAGGTCAGACCTGGTGGTC
GGGACTCGGACCCCCTTAGAGGCCTCCGTCCGTCCGGGCAGCCTTGCTTTGTGTAGTGTT
GCGGGGATCGCAGGAGATGGGGAGTCGTTAGATGGGTGGGCAGCGCCTAGTCTGGGAGTT
CACGACCGCAAACCGCACTGGCCCGGACTGGCCGGGAGGGGAAGTCCCCGGAAACGCACC
CGACGGGCATTATCGAGTGTCTGATGGGTAACGGCTCCAGACGCTGTAACACGGGGCGTT
GTTAAAGGGCTTCAAGATCAAATTGAAAACTCGAGATTGCCTTCGGAAGGATTGGGGTGG
TGGTGGCTACGTTACCTTCAACTGCTAGTCCATATTGGCCACGTTTGGGGCTTTTGAGGA
AGTTTTGAGTTTTAAATCCTGAGATGCGCAGGAAGGTAGTACCTACGTTAATATAATTAG
CAAATGGGATTGTGGAAAGTAAGGGAGGATTGTAGTTAACTTTATTGTATCCCTTATGAC
TTGGGGTGTGGTTTCAAAGGCCTTTCCGTCGCTGGGTTCTTCTGGGTTGGGATTAGAGCG
TTGCATTCTGGGACACAGTCAAGGACTCCAGGTGGGTAAAACCTGTTCCTCCCTTGGGCA
AATAGTGACCTTGTTTTCTGTTTGCTGCCCTTTTAGGTTAGTGTCCAGAATGCTGTTTGA
GGGATGAGACACTTTTTAAAAGAGTGGCTTCACCGCCCCACCCCCCATTCTCTCAGTCCG
CTAGTGTAGAAGTCTTCACAGCCAGAAAACTTTTTCCAGGCTGTTTGACGATGCACTAAT
GCTATAAACTTGAATGTTCTTAAGTAGGGAAGTCTCATGGGTTTTTTTTTTCCCCCTTAC
TAAAAAATTTAAATACATAACAGTCTTTACATAGTAATTACAAACTTCACAATGGTAACC
ATGTGATAATTGGCTTAATATTTGGTCGTTATAGTAACTCAGAACTTGGTTTGGAAATAT
CCAAAAATGACCGAAAGTAATTGTACTGTCTTTCTAAATTAGGCAAATAATTATTTGGAT
GGAAATGTTTAGCATATGGGTTTATATACATTTCTTTAGTTGTCAAAGTGAGATAGTTTT
AGTTTCTAAACTTGGAGTATATAAGTTGTGCGTGTTTTGGGGAGCAACTGCTGGTCTGTC
TTAAGTATTTTACTCCAATATAAAGTAGGAGCTAGTTTATTACCCACTGGAATCCAGAGG
TCAAAAAAAGTGTTTTATTTTGAAACATGAAGTGTTTAAGCTTGCTGTTCTGCCTTAGCA
GTTGCTGAGATGGTGGGTGTGTTGCCACACTAGCTTGAGCTTAACTGACCAACCTTTACA
AAAGAATTAGAGAGGTGCTCTTGACAGGGACTGTGTACTGGTGATATGACACAGAGGTGT
GAGTCTAGGGTGTTTTGTTTATAGTAGAACTATGTGTGTTGGATAAAGTTCAAAACTTAG
TGATTTTGTGAAGGGGTGATTACTAGGAACAGAGTAGACTGCTCCTCAAATATCATGGGA
GTCCTTTTGGGCATTTTTGAGGGAGTCTCCATAACCCAGGGTGTCCTGGAACTCCATGTA
GACAGCTCTAGCTGCATCTGCCTTACTAGTCCGGGGAGGGACCTGTGTGTCATCAGGCCC
AGCCTGTCCTTACAGAAATAAAATGGAGGATTTCTTTGCACTTGAGTCATATATTGCACT
TTTTGTATTCCAACAAAAACTGGGTTCTGAGAATAGTTTTCCTGGTACATGATCAGTAGT
AATATACAAATAAAATCATGTACATTATAAATGACCCCATATGAAGTGCAGCCTCTTGAC
ATGACTTATCAGGTAGGAGATACTTGAGGCTCCTTGTATCTGAATGCCTTGTAGAGACAG
TACTGTTTGTGAAAGCTAATTGACAAGCATAATGTCTGTCACTTAAGGCATATCAGTGGC
CGGGCGGTAGTGGTGGTGCACGCCTTTAATCCCAGCACTTGGGAGGCAGGGGTAGGCAGA
TTTCTGAGTTCAAGGCCACCCTGATCCCAGAGTGAGTTCCAGGACAGCCAGGACTATACA
GAGAAACCCTGTCTCAAAAAAAAAAAAAAAAAAAAACGGGGAAAAAAACCCCAGAAACAA
CAACAAAGACTGATATCAGTGGAAAGATAAGGTCATGGGTTATTTTGTACAGTCTTGATT
ATTGGAAGTCTCTCTGAACTCAAATAGGTGCCCTGAAACTTGGCAATCCTTCCTTCCTCC
ACTATGATATATAGCAGCAAAGCAGTAACAGTAACAAAAACATTAAGCAGTATTTCAAGA
ATGAGTGGTAACTTGTGTGGGTAAGAATATTTATTTAATATGTGCCTGGAAATGGCAGTG
ATGGCACGTAGTCATCGGCCTTGTGGTAAAGCTGGTTAAGGATTATCTGCGCTCAAATCC
ACAGCTTAAAACCTGTTATGGGCAGTTTGGTGCTTAGAGTGGACTATGGACTGCACTATC
CCAATTCCAAAAGTCCAGAGCTGAATTTGCACCTCCATCTCAGACTTGACTTATACTGGT
CAAAAAATGTTAATTGCTAACTTTGTGTAAAGTTAAAACCAGGGGTAATTAAAGTGAGGC
TGAAATTTAGAGATACTTTGTGGTGACAATGCTTTATGCAGGCTAGGGTACAAATTTGCT
TGTGTATATATGTGTTAAAATTGTGTTTGTTTGTTTTGGCCCTGAATCAAGGCCGCAGTT
TACTGAAGCTGTTGGTTTCAAGCAGGAGCCTAAAGAAATATCTTTCTATGGTCTGTTGGC
CATTGCAGAAATTTGTAAGTCTAATGGTCAATTCATTAGAAAGAAACACCTGGATGGATG
TTGTACCCAATTCTGTAATTGTAGCACTTGGGAGCCTAAGGCAAAAAGATAGTTTGAGGC
CAGTTTCCACTGCAGCATGATAAGGAGTGGGGGCGGGTCTCAAAGAAACAGCTGAGTCAT
TAGTGATAGATATGGCTAAGTCTCCATGAGATTCTAAGATTTCTGTATAATACTTATACA
TTACTGGTTTAGCTTAATTGTTCATTAAATTATATGTTAGATCCATTAGTAGGAAAAAAA
GATTACTGGGGGGTGGGGGGGAGCCCGGTGTGGTGGCGCACGCCTTTAATCCCAGCACAG
AGGCAGGCGTATTTCTGAATTCGAGGCCAGCCTAGTCTACAAAGTGAGTTCCAGGACAGC
CAGGGCTATACAGAGAAACCCTGTCTTTGGGGGGAAAAAAAGATTAGTGTGGGTTTTCCA
CAGAAAGGAAAAATTGTGTTGATAATGGCTTGATACTAAAGACTTAAGTGCTTCCTAACG
TTCTGGAAATGCACTTTACTGGGAAACCAACGGTCACATGAAGTTCCAAAGGCATATTTT
TGCTTTTAATTTGGAGCGTGAAGCAAACTGGAATATATACAAGTACTACAGATTTAGTAT
TGAATAACAGGGAACACATTAACTTAGTTTGGTTCCCCCCCCTCCAAGCCCCAGTACTAA
AAGTTTAGTAATCTCAGGTTGAGGTGACAACTAATTCTGGGACTAGGCTCCTTACTCTTA
CATATAAGTTACATATAACTCCCTTTTAGACTGCCTCTGACTTTCTCTTGCTGTTCTAGC
TATCCTAATACCACCAGTCTATTTAACAGGAGAGAATATTTTTTTACTTGGGTATGGTCT
TGCTCTTTGAGTATACTTTCCAGTACATGAATATTTTCTACCTATATCCTATAGACCAAG
AGTTGCTTCATGACTTTTTAGATTTTAAGGTCCTATTCCTAGAAGATAGCTCAATAACAA
GTATTCTGCTAGAAATTTACCCCTACAGAATAAAATGCCTTTCATTTTTGTGCAACTTAT
ATTGGCCTAATACTTTAACATAAACCATCAAAAGCCAGAAGTATATGCTATAAGTATAGA
TCGATACAGATAATATTGTAGTGTAGAGTTGCTTTAGAGAATTTAGTTTGTTTTGAGGAT
AAAAACCCTTCACAATTTCAAGTATCTCAAAGGTAAGGTTCCTGTATAAAGTGATGTTGG
TGGGAAAGATGGCACTAATCTTTGGCTGAATATTTTAATAGGCATGTCATGTTACCCAGA
GAACTCTCTAAACAAGTACCCAAAACTCATCTGATGTCCGAAGAGGAGTGGAGGAGACTT
GGTGTCCAACAGAGTCTAGGATGGGTTCATTACATGATTCATGAGCCAGGTAAGCTTTGC
TGTAAAGGAAAGTGATGTTGTTCCTTCTACCTGCAAAAGTGACTCACTTAGTATAAAACA
GGTGCCAAAATCCTGCACATATATAGAAATTGTTGCTACCTTTTTATACTTAAAAGGTGG
CATTGTTAAACTGGAGTCTTCCTTGGAATTATGGCACATATCTTTAGGAGCTCAGAAATC
CTTCCTATCAATAGGAAAGCAGAAGTGCTATAGATGCTGGCCTTCATCCCGTTGAATGAG
GAAGCTTTGGGTGGACTCTCTGAGTTTAATCTTTTAAGCCCCCACCCCCCCCCCTCACCC
CCCAGAGATCTGGTTTGACTAGAACAACCCTTTCTTAGCTAAGTGTGTATGGCATCAATT
TATTTATTTGGATGTGAATTAGCCTGAGATCCAGCAGCTGACTTGAATTAGCTGTTCTTT
TTTCAAAGAGATTACATTTCTCTTCACTGAAAATGATTTTGCAGGTAGAAATTATTTTCC
AGAGTCGGTCAAAGGATAAAATGGTAGAACAATGCTATTATACGAGTTTGTCCGCATTTA
CTATTTATTACACCGACAATTCATTTTGAATACTTCAAATAGTGACATGGAACTTAATAT
TTTCTTTCCACAGAACCGCATATTCTTCTCTTTAGACGACCTCTTCCAAAAGAACAACAA
AAATGAAGTGCAGCTGGGATCATCTAATCTTTTTCAAATTTAATGTATATGTGTATATAA
GGTAGTATTCAGTGAATACTTGAAAAGTGTACAAACCTTTCATCCATACCTGTGCATGCG
CTGTATTCTTCACAGCAACAGAGCTCAGTCAAATGCAACTGCAAGTAGGGTTGTTTTAAG
TTGTTCAAGATAGTTTCTTGTAGTTTTTTCTTAATATAAATGCCTGTTTTATTTTACCTG
TTTTGTTAAATAAAGTTTGTATATTGCATTTATATCACCATTGTTGAAATTAATTTGACT
TGATTATTTTTACCCCTGGGGAAAATAAACATACTTGAAAAAGAAATATAAGAAAATAAA
CATACTTGAAAAAGAAATATTAAGCTCCAAATGAGGATATTACAGCTTTATTGCCAGTTT
ACTTCCTAAATAACTTTGGATTCTGCAAGTGAACAGAAAAACCCACCGCTTGATAGTGTC
CACAAGTCTACAAAAAGTCTAGTGGTTTCAGAGAAAAGTATCTTAAAAGTTCAGGTGCCA
CATTCGTGCATCTTGTGTGAACCAAGAAATTAAGCACACATCAGTGGATAGCCATAAAAA
AAAGTATGAGTGGCCAGAAACAAGACTGTAGTTAGACATTAGCAGGGGTGATTTCTCATT
GAACACAGTAAACACTACAGAGCCACAGCCTTCCATGTGTGGGATACACTAGACCTAACA
GGGCTACTGACCATGAACTGGCACTGGTGTCTTGCTTGAAAAAAAGGGCTGGTGTTTAAT
TCTAACCCTACAGACTGACTCCAAGGCCTGTTTGCCAAATGCCCCCACATTGCAGGCGAC
CTTTTTCTGTCCTTCGACCTGTTTCTGTGCTCTTGGTTTCATTTTGGAGTTGTGTTTTGC
GAGAGCTTCCTGTTGTCCAGGCCCCAGCAGAAGTCTCACATAGCTAAACATTTGACTCCT
CTTAGTTCCAAGGTTCTTCATCTGCCTGCAGGCACCCGCCATGACATCCTACTAGAAACT
CCACAGGAGCAGATGCTCCTGGAAGCTCACCACTGAGCAGGTCTGCCGGCCTCACTCTTA
CTAGGAGTCTCCCTCCTGCACTGCATCAGTGCGGGCGCCCAGAGCCTGGCCTCCCCTAGT
GTCACATCACCAAGCCCGCCCCACGTAAGAGCTCAGCCGCGCCCTTCCTGGCCCACCACA
AGCCACCCCCTAGAGCTGTCGCTGCCCCAGTCTTCCACGTGCGGCTCCGGAGGCCCGGGA
CGCCGAGCACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1147, 5261..5388, 6013..6330
1089..1147, 5261..5388, 6013..6062
NM_025415.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved