Mus_musculus Locus Rpl3
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl3
Mus_musculus
Rpl3
15
SNORD43, snoU83B
1433..1496, 5762..5855
7558
tgtatatatgagtatagaggtcacctgatcccattacagatggttataggccacaatat
cgttgctgggaattgaactcagaatatctggaagaacagtcagtgctcttaaccattgag
ctatctctcaagcccttatttttttttaaagatttatttttattttatgtatatgagtac
actgtcgctgtctccagacacatcagaagagggcatcgaatcccagtacaggtggctatg
agccaccatgtggtcactgggaatttaactcaggacctctggaagtgcagttggtgttct
taactgctgagccatctctccagcccggtttgacttctgaaaatgtcacgcacgcccgtg
gcgcacattcgtacacacgggggggggggaacctcacacatttgtaaatctgaaattaag
aacaaaatatgaacgggacatgacatctggagactgaattggcagagacaggacttgagg
gagatgtgcccgaaatcatggcgcattaaaggcatggcttgattggaagactgagagcaa
tgttggtgatcacatcaaaatcactggttaggtaaaagagcagtttcattcagtctatct
taagagctcacgagaacaacgcagtcagttgtctcacactaagcctgcttcaacgccgtt
gttttcgttgctgtgtgggactagccctgtgtgattccgttctagaagtgagaggaagca
caatgcctccatttttcttcattatcatgaaatttggctgctgcagaacgccgtagttct
ttacattctaaacctcagcgtcgacgaggcgtttcgctaagcttgaacccaatcattctc
cgtagaccctatttgtcaatcctagtgggcgggaaaaatgtgtgtaaaatgacattcgat
gcgcgcccttcgacccgacgcctatgcgtcaacacgttcgcacgctcagggggcggagcc
atcacttggctttatatagcctgcactggctcctggtcgctctctatctgcggcgtgtgg
cggcgagatggtacgtatggccatgctgccttctaacttggtctcctgtgggcctggctt
gtattcacctcccatcggcgccatccctggctcgccaatcctgaaaggatgtaatagggg
atcgatgtgagggccgcgaccgtccggaaattcagggaccttaacggccttacggaggat
gtgtgtgggaccggcctgggcctgtgtgcgacccatttgatatcagcgtaatcctaaggg
acttatggaatgggctgttttgtgcttaattcgagggtagtggtcagtctggtagggatg
gcccaggtctttaggaatgcattggttaagtggagaaatttggcaaatcgggtcgggtct
ccattttggaatgttataagagtggaaggtgcatctctagagttctcagaagccacaaat
gatgaaccttttgacgggcggacagaaactctgtgctgaatgtcaagttctgatttggct
ttaggagggagtgtttgaggccgacttgcattagactccatcttgatacgccatgttgcc
atttagtcacatgggatactcttgaaagttcacccatcgaggttttagtataactaagct
gttttgtgtttgaaaggcatggaaactaaaagcattaagctgaagtcttattgcagtctg
tcctctgatacaattcctttaaatgtggaaccctcctttgggcttgattggaagactgag
agcaatgttgtgatctctccctttacctcagtctcacaggaaattctcagctcccaggca
tgggtccttgggcttcctgcctcgcaagcgcagcagccggcatcgtgggaaagtgaagag
cttccctaaggatgacgcttccaagcccgttcacctcacagcctttctgggttacaaggc
tggcatgacccacatcgtccgggaagttgacaggccaggatctagtatgtacagtacttc
cttgtccaacttgggctgtgtgtaattttgcctgtagttacagtaaattcccaaaggagc
acaatagcttcatcctggggtgctttgtggtaagtctagaacaaagcctgacttagtgtg
gtagtgcccacactaagggagcctagaagtgttttggcctagcgaaatttaacacagatt
cctgtgcagagtcctgttggggtagttggttgtttccatgccagtgcctgttatcaaccc
taggtactctgaaaaggtagacacatttaacaagtgtattctggacatgaaaccagacta
gtgataaagctcctctttgagacagtctagatagcacatggcattttgctacttcagtgg
tgatagtcaccacctggcatggtgcctgttagcagccttgcaaagtaagtggaggttaga
aactttggctcaattgttaaaagctgcagttggagagcccgcagttctgaagagcagtcc
tggaaggcccagtattctgatgcggagacagccattctgtctaaatggatgcttgtatgt
gctggggtatttgtgctcccactgaagcttatgcctgtttgtcttcacagaggtgaacaa
gaaagaagtcgtggaggctgtgaccattgtggaaactcccccaatggtggttgtgggcat
tgtgggatatgttgagaccccacgaggcctccggaccttcaagactgtatttgctgagca
catcagcgatgagtgtaaaaggcgcttctataagaactggtaagaggctcttgggttccc
ttagaagtaagggacactctgagctgggatgtaaagtgaaggaagttggatcaaaggttt
tttgaaccaaaagctgactgttaacccttgagggtgctggtcagtcctggttagcagaag
tgttagagttgctttgacactgaagtggcagggaagctggaaaacaagacatcctgcatc
tgggccttagtgtgaggtaatcctttgaggcttggatgctggccttgtctgtactagata
ggtcccctgcctctggcctgagcccctgacttccactactatgagatgtgcccccagata
aagggatgttctggtgccctggagcaagagttgtgtgttgtgtatatttgtggcttatat
taacctgtggacctctgctcagctccgctcggctctgcccgatgagcttcatccaggctc
cgcttgccggtggaaaaggctccttagaagccggcaatgagccccatccccaaatggtgc
cagtctgccttcctctcacctgttgcaagggtgatgaaggcctgcaccgggcccctcccc
caactgtgctctgctcctgaaggcacaagtctaagaagaaggctttcaccaagtactgta
agaaatggcaggatgacacaggcaagaagcagctggagaaggacttcaacagcatgaaga
agtactgccaggtcatccgcatcattgcccacactcaggtaagcacctaaggtttggggc
attttgcaggcattttgtgatccgaggggattagagacatttctggtgtcttaaatcaac
cagcagagggcactgtgacactgaggcttgcttctctagatggtcttactgtgctctatc
tgactaatctgaaatgatggtgtgagattgggccaagtattctgttttctaaacacattg
ctagttaggaaccatttagtagctcatgcatgagtccaccaaccactggcaaagtcaggt
ctattggctttgagcttctggtgatttactttctagtccatttgccaccagcctgatata
agcttcatctgcttcttttagatgcgtctgcttcctctacgccagaagaaggcacacttg
atggagatccaggtgaatggaggcactgtggctgagaagctcgactgggcccgagagcgg
ctggagcagcaggttcctgtgaaccaggtgtttgggcaggatgagatgattgatgtcatt
ggcgtgacaaaaggcaaagggtacaaaggtaagctttgctgtagtttgtgggtgataatg
tgagaccctggaacgtacactggacacagcaccaagtgatgcggtggcagcgtttccttg
cctgcctgccttctgggaacagcagtcagctggtcaagttgaccagcttttagagaatga
gctaagaaaaggagtaacacctcaaatatgtggacccagtcagttgacctcacccttaat
gccaggtggccatgaaggacaaattgggctccctagagtacatatctgcctcaaaccaat
aaacacatggcaacctctggccacatagtgacacatgaagctgcaaataactatttaggc
agacaaccatccagtctgattttaaaataggacaggaatgtggggttgggattgaattct
gatattcagatttacccattgttagataattttgtaatcagtgaactaatcacaggtatt
ttgagtactcattgggaagggacaggaacgtgcccagccccatgaagttaacattctttc
caggggtaaccagtcgttggcatacaaagaaactgccccgaaagacccatcgaggtttgc
gcaaagttgcctgtattggagcctggcaccctgcccgtgttgccttctctgtggctcgag
ctgggcagaaaggctaccatcaccgaacagagattaacaagaaggtaaggctgattgggg
atcctgcaaatgagagagggtattgggttcatagaacagtcagtcctaggaatccatgac
actgcctaacccaggtttaattaatgccctaaccctttcccaggaaatttttgttgttat
tgttggaaatttttaaaggttcaattataagtagtttaaaaaaatttgagtatactgtag
ctatttcctgacaccactgagggcatcagatccctgtacagatggttgagagctctacca
tgtggttgctgggaattgaactcaggacctctggaagagcagttagtgctcttaatcact
gagccatctatctctccatctctataagcagtttttatgcattttgagataacagcagca
tagcatgcgctgccttggagttgtagcagtcctgtgtctgcctcaggattattaggatta
caggcctgagttgctaccatacctagatttagtagtttaagatgcttggtaatggccggg
cggtggtggcgcacgccttaatcccagcacttaggaggcagaggaaggtggatttctaag
ttcaaggccagcctggtctacagagtgagttccaggacagccagggctgcacagagaaac
cctgtctcgaaaaaccaaaaaaaaaaaaaaaaaaagatgcttggtaactgtaaaagagga
gccgcttacctttgtcccaagttctagaacagagttccagcaaatagtgttttaatctgg
cccattacatgggaaaacacaattatagacctcccactttatgctgatttgggtaacagg
ccagtcactgacattcagggtttctacctgactttggatgctggttctcaggactgactt
ctcagttgttgactctcatgtgcagatttacaagattggtcaaggctacctcatcaagga
tggcaaactgatcaagaacaatgcatctactgactatgacttgtctgacaagagcatcaa
cccactggtgagtgctgggggctgagccttaggatatatctgggacaggacctgccatgc
gtgcctctgcacagcaactagctgagtccactaggtggggttggtgaaagatgtcagaat
cagctgttctgtgatgaggctctggaatgtgcgctgggcacagcgcccgagagagactga
ggaattattccctgttgccttccttctgagaacagccctgttgatcttagttgcctctga
tacagctaactgccctcactgaccaatggctttctatgattccttagggtggctttgtgc
attatggtgaggtgaccaatgacttcatcatgctcaaaggctgtgtggtggggaccaaga
agcgagtacttactcttcgtaaggtgagactgatcctgggctctaaccagtcattctggg
catgggggatcacaggccttgagctatgcggaaattggcctgtctgggtattgaaatcct
ggggaagggtggactttgcattagccttttacccactctgttctgtgtcagtgtggtggc
tgtttgagcgggtgctaagtatttgaacgctgcttgtcagctgctaagcattctttttgg
cccatagtccttgctggttcagaccaaacgtcgggccctggagaagattgacctgaagtt
cattgacaccacctccaaatttggccatggtcgcttccagaccatggaggagaagaaagc
atttatggtaaggacctacctgggctggggtgcctggtctttgtttgcctccttggctat
gttcagaactaatgaaactcctctgtttctcctctacagggaccactcaagaaagatcgc
attgccaaggaggaaggagcttgattccaggaccactttgtgcagatggtggggtctcac
caataaaatatttctactcacactggttttcccacatttctttttttttttttttttttt
tttggttttcaagacagggtttctctgtatagcccgggctgtcctggaactcactctgta
gaccaggctggcctcgaattcagaaatccgtctgcctcccaagtgctgggattaaaggtg
tgcgccaccacgcccggctccacatttctttaagagcagtggccagcctggtagccacta
agaactgaagagcctagtttagcaacatttgagttgttgaatgaaactgacaggtttgca
atgcaatgcctaaagcaattgttggggctactgaagagtaatgtgtccctaatgtatctg
tcacagcttctgtatcccctcccagtctgtacagagtttgggtctctgtttcttaggtat
tattgattaggccctaggcctgctaaaacgtgcaaaaggttgggtttgatctacctgatg
gtttatagttggcttgctctctatctagtattaccatttaataggccaaccctccttaga
acagcttggtttggctctgaggctctaataggagcttgcatccaatccagatagtatgag
tctggggtttgaccctgcaacccagtgaaagtgggattgatgctaaatcgggtgatgatc
agcaacttgaagatgtatagattggtataacattgtctacatcagattaaaggctgctca
tgagcctctggcctttcataatagtgctgcaaccctacatgggaagaggctttggaggtc
tgcagaggtggatcagtgctagctgttgatgctgtttggcaatttaggctgtacttcagg
cgtgggccaccagggggtgggtgtagcacatacatggtgaaaacccagcaacactcagtt
gcattctcacaatatcttgaccccaggcttgggctcttttagggacctcttaggtctgaa
ggaggcattgaaagattgcccattagtgtggccagtatcagacccccagagcaacattc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1771..1963, 2570..2738, 3322..3457, 3801..3987, 4503..4663, 5545..5646, 5927..6022, 6247..6366, 6459..6558
1027..1029, 1771..1963, 2570..2738, 3322..3457, 3801..3987, 4503..4663, 5545..5646, 5927..6022, 6247..6366, 6459..6503
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved