Mus_musculus Locus Rpl30
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl30
Mus_musculus
Rpl30
15
SNORA72
3301..3432
4713
gacaggttagactaggttggctggctagccagccttggggaatctgttccacaaatgga
gttacaagtgtgcacaaccatgccagacttttgggggctggggattgacagagaggttta
ggcataaaatgcaggtccccacgcttgcaaggcaagcacactttactgactgaacaatct
caacagccctgggttttcgttggtgctagtgcgtaaatagtagaggctttcaaggttttt
tttttttttccttgaatgctacatttatacaacggcccaagtttcgtagcaaaatgattt
tttaaattattcgtattgcgactatttctttacttctgtatacgtatgtgagcattcaag
cgcaggccaaagaaaaacctgctggacttggcgctcccctcccaccacgtgggtttggaa
ctcattcgtctacttagcgacaagcgcatttacccgtcagccacttcaccaggttttttt
tttttttttttcaattgtggtccctgtgcaaagtaggctcccaagtacacggtataaaac
cgccgcaaaaggggtgtgtgtcctacggagcggcaaacaggaagatcagcggcgggtgga
cagagatgcctccgctcctggtgagcagtcacggggtaaaccggcggcccggggtccttc
cggagcacgcccaagacaacgtcaggcggagaccagcccaggagaggccaggtcgctgcc
gcctcgccacggagccctgggcctcgtcgtcagctcccatcgagctccggctctccgcgg
tgtcagcccgctgcagcagaacaaacgcccagaaccgaaggccggagcccagacgccgca
gcagcccagcctgcgttgtaacccggtccccatagcaaccaactaccgcagactactctc
gcaagcgctgttctgcttgtgacccggaccggcttctcttccgcttccggtcccacaatc
ctctgtcggcctagaagagctttgcattgtgggagctccttcctttctcgctccccggcc
atcttggcggctggtgttggtgagtgagctctgcggggtaaacgattaggcggctcgggg
agctccgctagctggtgtttgacgctctggattataatcctctcttctgtcctctgtgta
tgctaggttgggggttgtcccgcacctaaggcaggaagatggtggccgcaaagaagacgg
tgagtgaagccgatcgggcccggaagccggttcacgtggagagctgggtcgggccggggc
ggatagatttgagcacactgggtggacgacttgtcgctgacgtttcagggtctcaaagtg
aatccgagaggctctttgtatggtctcagacatcatgaaagggttcagttccagaaatct
ggaactgagtttggttttagatgactgcaagtggtgttcaagtctcaaacgtttgcattg
tagaaaaagtctctggagtcgatcaactctaggctccaacttgttatgaaaagtgggaag
tacgtgctgggctacaagcagactctgaagatgatcagacaaggcaaagcgaagttggtt
atccttgccaacaactgtccagctttgaggtaatggagggaacctggatgtgtgcagcct
attgtaaattcactgtgcagtatccagcattgggaagaagaataatgatggttgctttct
gatgtttggaccttgctttgtgtgtgttttttgtaaatgtacctttgaggcacgttgtgt
gacaggaggtatacaaatgatacacgcagactgggggaagcccgatcccgaatttttcaa
ggtttgaagtgttaacactccgcttcatgtgcctgttttagtttagaaaaattctggctg
gattatggaggtgatggtatcatgaaatcacctatttggcagggtccaattttctgaaca
cgttcattcttgattaactattttaactcgaacctaacaagtattttaagtaagctgaag
aagcttgtgtagtatacgctccttgatttttctatggcaattgtacacctcttcagcctt
ttatgtaggtgtctatacttagtggcagagtttggaatgtttggtcttattttaaacctt
tgccagtcgattcatagtggcagcgtagacattcattactaaattacaagctcagactca
gtgggtccaggctggagcttcaagttcatttctcataagcactttggagcactgttggta
tgtggggccacattctaagctcaaggttctgtggaactttcaaatcttaacaatttgtat
cctttaacttggcactgaagtatttattttttgggtaatattatcagcagcccttatgta
gtattcactgtatagtaggtggtttaagagggcttacttttttaggtttctgaccctcca
ctccaccttcctattattctttgccttcgtttgattaaaatggagtatatacttgttgct
gacacgagattctcctggtgttgtgaggtggctgatgtgaatgctggaaactgaactttc
ttaagagcagtacaagctttcagtgaaccatatctccaggccagcattggcttttttatg
tctattatacccttttctagtttttaagtaacttacacattttaaacttagtaaattgaa
acatgaatacaatgtactttaatattggatactacctccaaaaagttaggtatttaatta
tcacaatacactagtaaaggatccatgataatcaggacagctagaatcttttttaagagt
tggaagtgatttagttactgttaaaaaggcctcaccaatttgtcacaagtctgtcagtac
cttggtatggcattttatttgactttttgttgttccctaaggaaatctgaaatagagtac
tatgccatgttggctaaaactggggtccatcactacagtggcaataatattgaactgggc
acagcgtgtggaaaatactacagagtatgcacactggctatcattgacccaggtatgttt
ttaaaattatatttttttctaatgtaagtgcttattagacagtggctttggttcaacttt
gatattaagaattttgtttaatgcaagttctaggacaactggggcagcacagtgaaactc
tttgtccctctacccctctcaacccctcttaccatacccccccttgggaagaaaagtttg
gtagaaggtgaacgagataaaattttaccacctctttgttgcttggggataaatagtttg
tggtaaatgcctgcattctattttattttgagcttagaaattttagttgccttgtagaac
actgcgaatattctcgctgttctgattctgtgataatcaggacaggctagacattcgcta
tagtaagaccatgcatgtgtccccagacctagttctttacttcagtctggttatctaaat
gctggtgacagaccatctgattcattatttgtataggatggctgagattttaaggtattt
ttaagtgattttaagagtgatagccgaaacaatttgcacgtagtgctaatctgccttctt
acctaaagaacaagtaggggaattctttaattattagttgccattaaatgacttgtaaaa
ctattattttattttctaggtgattctgatattattagaagcatgccagaacagactggt
gagaagtaaacaagaaagttttcctttaataaaactttgccagagctccttttgaaaaac
atggtgtctgtttgctttctaacatttagctttcttgaaaccacaggcaagacttgggtg
agaagttatactgcttggttttcattttgctggggttttgttaaaagattgtacactgta
tcactatgcaaaatgtgtggaccagagaagtgtttgagtgtatattttcaatattgaaat
gcacatttgtggtgatacaataatatctaatcagaaggtcatttggtgtttttaatcact
attttatatactgaggtaagatctctcacttaacctagagtttggcagtgccagctagtc
tagctaacttcctctggggagcctctctggacaccctaagtgatagaattgcaggctggc
acccactgtttattttatatgggtgctggtggtccagtttcagtcctcaaacttgcacag
aaagcttctaagctgttatccctagcgccttgtaaagacaggctcggggttctagtctca
gggtgtttgcattgtatttttgggtatgtttgagaggcatgggatgatttgtgatggacc
aaagctgtggattttgcatgctattttgaataatttagaactattttcaaattaactatt
tcctacttagttccttaaaatatggagagttcctgtgttgtgacttggctataagcattt
aatttttttttcctagagctttgtaggtagtgataatatgagataattttttaaattttt
gtgtagtcattgtgtttgcaagaagggtttaaaatgcaaaggaacgtttaaaagctatgt
ggtaggagacacaacttactctgctgtgtttcatggagaatctgtaagaagtaccattct
gctgtttctaaggaggaaaggtcactgtcccacatcaggggttgtaaaaagtggcatttt
aaatgtgcaggggaagccggccgtggtggcgcatgccttgggaggcagagtaaggtgggt
ttctgagttcaagaccagcctggtctaccaagtg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1146..1198, 1443..1588, 2861..2991, 3619..3713
1178..1198, 1443..1588, 2861..2991, 3619..3668
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved