Mus_musculus Locus Rpl37
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl37
Mus_musculus
Rpl37
15
SNORD72
2792..2872
4029
tccctcctctgatttcagtttactacttctgagtggaaaggattatacatttttctttc
tactcccctcccctagaagaaattggtacgatttgctaacaaaaaacaaaacaaaacaaa
aagcttccttggtgtttgctttgttctgctgtccactatcttaagatttttgaatgtgat
agactagcgattctcacatttgttttagaaagtatgtagatggtatgactgagacttttc
cccaattcatcaatgttcgtactatattctccatgtttcctactgggattgcggacagac
agttgcattagcgctaatcaaggatgtctagggttacttatttcaaaatgatctaggaaa
gtgttttatacagtacagacttgcaaactgtactcaagtctaaaagggtcagatttcctg
gtggcggcgcgctggctggaagctgttatttaacaagttccgcgtgtgattccttgagtg
cgatcaaacaactggcctctgaatgaccaccgcgtgaaatcgagtcggcccgagtcagaa
gctaactaagctcctaccctcgccgagacacttcgtgactccatcctctcaccaactctc
catacaggcaagcgagcggccacatcaaaacgaacctgggaaggctggctttcccggatc
gggatcccagtcccagcactgcacaaccgccaggggcgccgccacgcactgggtgtctga
ctcccctcgagccccgggaccggaaaccagacggactgccaacaccgcagcagccccgac
accgccagaaaccctctccaaccaggaggcgggccgctggggagggcggagccacagcgc
caggcacgccccctaccggtgttgcagcccaatcggctccctggctctctcgcccgggag
actacacctccgcacccgaggcctgatagggctgcaccaagacccgccggaagtagtttc
ctgggcggaagcttatccacaggaagtggcgggggtgctttCTCTTCCGGTCTCTTTGGC
CTCGCCGGTAGAAGCAAGATGgtgagtgtggtttctgggctctgtaaatctctctccatc
cttcttcctcgggctgtcctgcctgttgcccggcgcgtcggtgacaaggttgcgagtgag
gggagctgatgggcgaggagacggcgtgctgtggtccgcaggaactggaaggatggctgc
tgtgtgcagagcccggcccacggtcctagcgccgctgtgggtctctctgggctttggagg
agacgtacgcactgcagccccgggtgggtgatcaggacaggcttggggacatctgtcccc
agccgccgagaaaccggctgcttggtgggcagtaccgcgactgagagacgggcagaatgt
tgtccttaacgcctaaagccaaggaggcttaggtccgcgcagagtaaggcattataatgg
tcgtgtggatagccggtagtgcttcctacctaccctacctgtgtgctaagatttaaatct
ttacaccgttttgtcccgtgtggatcttgtttacgtctcatccatactcattgctaagaa
aatgccagagtacattgagaagtcagatttcagagttgcttatatgtggggttttttttc
ctgctttttcttttaatgtgcagACGAAGGGAACGTCATCCTTTGGTAAGCGTCGCAACA
AGACGCACACGCTGTGCCGCCGCTGTGGCTCCAAGGCCTACCACCTTCAGAAGTCGACTT
GTGGCAAGTGTGGCTACCCTGCCAAGCGCAAGAGGAAGTgtaagtactgtaatccgcagg
cgggcttttaccttgacctgaggtagcgatgtaatagaaaacacatttggcacgcaacaa
ctttggaggttggtttgttggctgagtggttaaaacatagtaatgacactactgagaaaa
tgggctgacactgggtgcttgggaaaaccatttggaatcctattttttttattagATAAC
TGGAGTGCCAAGGCTAAGAGACGAAACACTACCGGGACTGGTCGGATGAGGCACCTAAAG
ATTGTCTACCGCAGATTCAGgtacagttttggctaaatgtcattggtcctccagggtagg
atgaaactttgcactcttactgaagggtaggaatgatactggggtttggtgtgggcctga
gacgcccacatttgtcaagactatgagtgggatctggggggcagcttacttggatctgcc
tccagactttgctcaagtctgctaagctgttctgggtgccagtcataacatagatgggta
tctttttactggaggctaggccttgatgttccttaaaagtacagaatccccagcccccct
cttagactttcctgtggggtctgtgctttgacaggtgcttttgtgtttgtctctgtttta
aactcagtccagttttgtgaacttgatgtgtagtggcttgctagtgtttgataggctagt
ggcatgttttgagcctgattaacctttatgtgcttagaatcactcatcttcctatgtagt
attgagtagaaatgagtgctacttaacatttagacttctgagttgagcagcttcaagatc
ctgttaagcttggtcagtgtttcctgttactaaaggaaaggtgccaggacctgtccttta
tagcttaaggaatagcttcataaatactttagttcttgtggaaatagggaaaatgagccc
aaaattgttgagacagttaactttaatgtaatgtgggtgtcttgattagggtaaactaat
agcttatcaatgatgtcctaaaaaataaatgtctgaacatatgactgctataatgatttc
agcatttaactgagataagctcattacggtctgcttgatcaatttggaggcaatgtttga
tattgctgctttaactttttttcttatctttaacatggcacagACATGGATTCCGTGAGG
GAACAACGCCGAAACCCAAGAGGGCAGCTGTCGCAGCATCCAGTTCTTCTTAAGGATTTC
AATCAGTCATAAAATAAATGTTCTGCTTTCaaaaattctgtggtgatctaaggtacttta
acatcggttcagagttcggttatatgattgctctgggatcctacgcttcttccttcatag
ttcctgtgggtccgaagctgggaggggctgggtggactctcgggaaagatactctgagcc
tgtctcggtccccatcgtgtttgcttggccctgggcatggaagtgggtgagtgatgagct
gaacgagcaggcttgctagagatgaggacagttactggtgtggttatatcactaccatgc
ctacagtgtcttaagacgcttacagtctgtaagggacttaaatgatttgagctcttactt
atcctgtagtttctgatttttaacatttacttgaataaagccaagcaagataagccttta
ttcccagcacttggtgacaggtggatctatgagttggggatcagagctacacattaaaac
tcttaattcatcttactagaactcatagtccgtgtagacttaagattggtgtgtggtttc
cttactatggctgaatgtgtaatttctatcaaggcttaaatcagacactgaggcaagtgg
gaattaagctctgggtgtcccgacttgacaaactctagagatgggaaagattaatacaac
tctgcaagataagtggggcttgaaaaaaagcttgtgttaggatttgcaaggtgacctcaa
gcttggtggtggctggagcagctcgggcctttaattccagcacatggggtgcagaggcaa
actcaaaatcttaagtttgaggccagcctggtttacagagttagttgcagacctacagaa
aaatcctgtcttcaaaatcctttcttaagctaatgcctgtgggagaatttgggtgtttgt
gatgtcagttctagtatgtaatggagttgagaaaaattacagccacaaagctaggcaata
gactgctaaattgagggtagggtgcagatctattattcgatactcagtgtgtctagaatt
gtgacaccaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 1643..1778, 1975..2059, 2923..3029
1038..1040, 1643..1778, 1975..2059, 2923..2992
XM_574022.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved