Mus_musculus Locus Slc25a3
snOPY snoRNA Orthological Gene Database
Mus_musculus Slc25a3
Mus_musculus
Slc25a3
10
SNORA53
6432..6677
9175
AAATGAATGAAAATGTCTTTTGTTTGTAAATGTTAAGAATTTTTAAAGGACACAGCAGA
GCACTGACTGCAGAGGTAGACTTAGTATAACTACAATAGTCAATACAGGAGCCAGCTCTA
GTGGTGTCTTGGGTTAGATAAAAAGGCTTAATAAAGATGAGATAAACGTCCCAGGAAAAT
GTTAAACGCAAGAATTACAACAGGTTTGATTGCTTCTAAACTCTCCCTCGTGGAACTTGG
CCCCCGCTTGTTGACATCAGAGTGATGATGATCTTGTAAATGTCTGAAGTACACACAGTC
CTGTCTTACACGCACACAGTTCATCGGTTACTTTCATGTCAGCGCATGCCTGTGCCTCCA
GGAACGAAGCCTTGACTGACTGTTCTCAGGGGCCATGGACATTCTGTGAGGCAGAAGCAG
TTTTATGTATTGTATGAGTTCTTCCTGTATATCCTTTCCACCAGAACTTGGTGGAAAATT
TAGACATGCCTATGTCAAAAGTCAGTGTGATGGAATTTTTTTCTGAAAAGTCCGATGATG
GCAGGAATTCCGATCAAAGATCTTGTAGTGATATCCTAGCTTCCATACCTGAATAACGTA
TCACTTAAGCATTCATGTCTTTAAAAGTTTATGCCCGCAATCACTTAAAGACATGTAAAA
ATTCCTGGCGCCAAGGAGAAAACACCGGAAGGTGAAGGGACAGAGTGAGTAGGTCACCTG
CCCGTCCAAGGCCAAGACTACACTTTAAAAAAAAAAGGGGAGTGGGGGAGGAGGGCGCTT
TGGATCTGCGCCTGCGCAGTAGGAATCCTCCTGCGCACTAGCAGGGCCGGAAGGGCTGGG
GTTGGACGTGGGCGGGGATAGGGTTGCTAGGAGGACGCGATGACGTCCAGGTTCTGCGCT
CCTCTCCGCAAATGAGAGGCGCGTGGCGCAGTGACGCTCTGCGTGCGTCACGGTGACGCC
GCGCGAAGGGCACGGATCTTCGGGCCGGGAGGACATTCGGCCTCTGTGAGCCGCAACCTT
GCCCAGCGAGCGGTTGGGTGTTCGCCATCTTAGGCAAGTGAGCGCGACCGGGCCTCGCCG
CGGCGCGGAGCCTTGAGTCCCTTGTGGCCGCCGCCTTGGCCGTGGGCCCGGCCGGGCTTG
GCGTCCCTGGGGAAGAAGCTGTGACCTCCTCAAGGGCGCAGAGCCGGGCATGTCTCGCGG
GGCTCCGGTGACATTGCCCGGCGCCGGGTCTCTCTCACCTCCGCCCTCTGTCTCCCCCGC
AGGAGGATGTTCTCGTCCGTAGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCACAC
CTGCAGCTGGTGCACGATGGCCTGTCGGGTCCCCGCAGTCCCCCAGCTCCGCCCCGGCGT
TCCCGCCACCTGGCCGCCGCCGCCGTGGAAGGTGAGGTCGCACCCTGCCCTGTGGGAGCG
CTGGTTACATGCTGCCCCCCTGCTCTGCCTCCCGAGTCCTGGGCAGGAACTGGAGGTCGG
GGAAGGACGCTTCAGCCCTGGACCCGAGGACCGGTCTCTCGCTGACCCTGGGATGGCAAC
TCTGACACCCTAGGCCGCTGTCGGATCCTTGGCCCTCCCTCAAGGGCGTGGAAGGGCCCA
GGCCCAGCGCCACTCAGTGACCTCCGTGTCCCGAAGGGAGTAGAGGCAGAGAGGTGGTAA
CCAACTTCTTTATCTTCCCCCGTGAGCCCGCTTGGTCAGCCAAGTATACTGGGTAAAATC
TCTTTTTAACCACTAGCCAGACACAGTTGCAACTCCATAACGTTTATTTGACTTGCCTTT
TTAAAAATTACCTGGAAAACTCTCCTTTGATCTCCTTTCCCAAGTTTTATCTTTTCATTT
AATTGTATATGAGGTAATGGGGTTGGGAATCTCTTCCTTTTGTGCTACTGGTTGGTGAAG
GAGGTGACTTGCAGATTATATGAGGTGTGCATTCCTTTGAGTTTATGTTTTTGGGATTTG
AGCTGGGTGACTCAATAACTGTATGTTTTAAATCCTAGTGGAACATAAGTACAAGAGAAA
CCCGAAAGCTGAATTATAGGCCTCAAGAGAAACGTTACCTACATTGTGTGTGTAAAACAG
AAGTCCCCACCCACACCCCAGTCATTCATGTGCTTCATGCGTCTTAAACGTGATTAGAAA
ACTCCTTTTCACTATCTCCTATCGTTTTCCTCTGATTTCAAAAGCTAAAGCAAATCTTTG
TATGTTTTTGACTGCAGGAACTAGGTATGACTTACTTAGTTCATAAGTGAGTAGTTGGTT
AATAGCTGGAGCAAACGTTAAAGTTAGCAAGCTTTGCACATGTTAAGTGCTCTTTTTGAT
TTTGGGCTGTCCTTGGAGGGTGCTCTTAGTAACTGCCTTTAGTTGAAATTACCAATGCAG
GAAGTTTTAGAAAATAGTATCTCACAGATACTAATAATTTTAGTGATCTGATTTGACAGT
GACTTTCATGTCATTTACATTATATGAGAACTCATCTTTCTACCTAGTTGTGGCTGGTGG
CTAAAGCTGCATACTAGTGATAGTACTATACCAAAAGGAAATAGTTTTTTTTTTTCCTTC
CCCTCGACTTCCTTAGTCTCTGAAGAAATAATTGATCTTTTTTCTTCAATCAAACAGAGC
AGTATAGCTGTGAATATGGATCTGGCAGATTCTTTCTCCTCTGTGGCCTCGGAGGAATTA
TTAGCTGTGGCACAACACATACAGCATTGGTTCCTCTAGATCTCATTAAATGCAGAATGC
AGGTTTGTGTTGCATGCTGGACTAAAACGTTCTGTTGAAACGTGAGTTGTAAGATATAGA
CTGCTACTAACAAGCTGTGTGGAAACCTAATTGCCCAGGAGGTAAGTTGATGCACACTAA
TACGAGTCCATATTAAAATGCACGGTGTGTCTTGTCTTATTACAGAGTACAGTTGTGAAT
TTGGCTCCATGAAGTATTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGGCTGA
CACACACTGCTGTTGTTCCCCTGGACTTAGTAAAGTGCCGCATGCAGGTTTGTATTGTTG
GCATGAGTGGTTTTATTTATATTTTATTATTTGCTATGATAACATTTTGATTATGTAAGT
TATATATGTTATGTGGGTGGGTAGGTGTGGAAATAAATAGACCACTTTTGGGAGTTCTTT
ACTTAAACCATAGGGAACCCAAGCATAGCACTCAGGTTGACAGGTTTGACAGGCAAGTGT
CTGATACTGACCCGCTGTGTCTTGTGTATGTGATTTACCTTACTAATGCAAAGTTGTTTT
AAACTAAAGTACAATTATATTACTTCTTATCCCTTTGCTCCCAACAACCCCTCCCATACC
TCCACCTCCCACTCTCTCAAATCGATGGTCTCATTTCTTATTATTGTTACATAGGAATTA
TGCTGGAATCAAGGTCTTAGTATGTGTGCTAGGAGTGCCCTCTACCACTGAGCTACATTT
CTAGCTTTGTTTAGTTTTCAAAAGATTTCTACTTCATGTGTAAGGGTGCTTTGCCTGCAT
GTATGTTTGTGCATCACATGCCTAGTGTCCAAAGAAGAGGGCATCTGCTTCACTAGAAAC
CGAGTTATAGATGATTGTGAGCCATTATGTGGGTGCTGGGAATCGAACCCAGAACCTCTA
GAAGAGCAGCTACTGCTTTTAACTGCTGAGCCATCCCTTCTGCTCCAATTCTGAGCTTTT
TGTTTTGTTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCTGTA
GACCAGGCCGGCCTTGAACTCAGAAATCCGCCTGCCTCTGCCTCCTGAGTGCTGGGATTA
AAGGCGTTCGCCACCACGCTCAGGTTAATTGTTCTGCTCTTACTATAAGTGGATCTTAAC
TGCTGGCATTCAGTTCTGGCCAGAGGTCTTTTTCAAAGCCTACTAATTCAAGACCCCCAA
GTAGTCACTGTATAAGTATTTTTTGTATCAAAGTGGTCAGTCAGTCTTGTGTTATCTCAT
GTGAACTAACTTCCTGTCCCTAAATATTGAGGCAAAGAACATGTTTATTTCTCAGAAAAG
TTCTTGTTGTCTTTATAGGGAAAGTGAGCACTGCCTCTTTTGTGTTTTTATAATTTGAAT
ATCATAATAATTGAAAAAAAGTAATGAAACATTAAAAATTTATTTGTCCCAAACAGGATT
AGAAGTCTCCTTACCTAAAAGAGAAAGGAAGTTGAAATATTAGGAGGGAGAGAGGAAGGT
GATGTATACCAGCCCTTCTAGTACCGGCAGAGAGTGAGATAAGCTCCCTTACCCACAGTG
TTGTTAAACAAATAGATACCAAGTGTAAGTCCTGAAACATGCGTGTCTTTTGGAGTAAAT
TTAATTTCTGAAGTAAAAGTGATTCTGTACCTCAGAGGAGATGCTGTACCTCTTACAATT
GTGTCTAGTTGGGTTATCTGATGTTCACAGTGGTTCGTAGTGCAGTATCATCTACGTAAA
GGACTCCGGGATCAGGAATACATACTTATATCTTAAGAGCAATTTTCTTTTTGGAATTAC
ATAGTTTTTTACTGTCCAAGAATTATTATAATTTAAAGGAAGTTAGACCTTGATATAGAA
ACAGTCCTAAATAGAGCCTGGGAGTGATGGCTCATGCCTGCAGTCTAGCCTCTGGGAGGC
AGAGGCAGGAAGATCACTGTGAGTTGGAGACTAGCCTGGACTCCTCCCAGTTTGCCTGGG
AAGATTGTTCAGTCTGTAGAGTGTTTGTTATGTAAGCCTGAAGAACTTAGGTGAGACCCT
CAGGCACCTGTGTGAAAAGTCGGGCATGGTCATGCACCTGTAACCTGTATAATCCTAGCA
CTGCCAAGGCGGATAGAGAGGGTCCCCGGAGGTCGCTGGCCAGCTAGGCTGGTAGAGACA
GGAACAGTGGTAGAAGAGATTCCAAAGTAAAGGGCAGTTCCCAACATTGACCTCTGGCCT
CCACATACATGCTCACAGAAGCATATACACAGGAATATACCACACAAAAAATTTAAAAAC
ATAGGTGTTTAGCTTATATTAAGCTAAGAACTTTCATATACCTTTTGTAGTTAAATTTTA
AAACAAAAAAGCACAGTAGTAGAATAAAGTTTTTGTGAAAGGTGTTAGATATTCTTAAAT
CTTAATTTATAAAACTCATTATAAATAACTTGGCAAATAAAAAAAAACACAACTAAATTA
ACATAGCTAATTCTTTTATATTGACATTTTCCCATTTTAAAGGTGGACCCTCAGAAGTAC
AAAGGCATATTTAATGGATTCTCCATTACACTGAAAGAAGATGGCGTTCGTGGTTTGGCT
AAAGGATGGGCCCCAACTTTGATTGGCTATTCCATGCAAGGGCTCTGCAAATTCGGCTTT
TATGAAGTCTTCAAAGCCTTATATAGCAACATACTTGGTGAGGTATGTGATTTTACTTTG
ACATTTAGTGTCCCAAGTGTTTGAGAAAGATGTTATGCTTTTTGTTGGGCTTACCTTGTT
TTATGGCTGAAGAAATGGCCCTAGAAAGAGTGCAGCATGTCTCAATTCATAAGGCATATT
TAGCAATAGCAAAGACAGGATGAAAAGCAAAGTGTATTTCATAAGATTCTAGCTTCTCAA
TGTACTATGTTATTTCTAAGTAAGTATGGGTGGTGTGTGTGTTAGTGTAAGAGAAGAGTC
TGGGGTTTCTCTTATGTAGTATAGGATTACTGTATGTGTCCCATCTATATTCAGAGTATA
TACCTTGTATTAGTTATGAGGTTGAGAGACAATATAAACTTAATTCTGACACAGTGTTAT
TCATGGACTGTGTAATAAGAGTAGTTCAGACAAGTCAGGCAGGGTATAATGTGCATCTGT
TTCCTAGCATTTGGGTATATTGTGATTTTTGTAGCCAGATTGTCCCATATAACAAGGCTA
GACTAGGATAGACTGATGAAGTTAGATCTTAAACCAGAAAGGGGGAGAGGAGTAATTTTA
GAGTCTCTGAAATCACATTGTCATAGAAAGTTAGATTGAGATGGCCACGTGACAGCGGTT
TATATCTGTTCTGTATATTGTCTTTTAGGAAAACACCTACCTGTGGCGCACATCACTGTA
TTTAGCTTCTTCTGCCAGTGCTGAATTCTTCGCTGACATTGCCCTGGCTCCTATGGAAGC
TGCTAAAGTTCGAATTCAAACCCAGCCTGGTTATGCCAACACCTTGAGGGAAGCTGTTCC
CAAAATGTATAAAGAGGAAGGCTTAAATGCGTAAGTGCGTATTCTCCTAAAACGAGTCAC
TGGGGAGAACCTAAAATCAAGTCCTGTCTGTCTGTCTGTCTGAAAATGATACTTGTCTAA
GTATCTATTGACTCAGGAGGATGGGCTTGTTAGGACATTTCTGCTATACACAGTTTGCAT
GTTTCAGATGCCAACATGCTTCCTTAGATCCACCTTTGTGGATGGGTCTTGGACTGAGTT
CTACCTGTAAACTTCTTGTTTCTTGTGGTTCCAGTCCAAGAAACGTCCAGCAACTTTGTT
GGTTGTATAGTCGAAGGTGCTTGAGTCATTGGCATGTGAGACTAATATACCTGCATGCTA
GTCTTCAGGTTCTGATGGAAGTGACATGCGTGATGCTGTCATGTGTTACTGTCAGGACTC
GACTGGTGTGCGGACACGTCTGTGGATGGTGAAAGAAAATCTCTGCTAAATCAGTTTAGG
CACCTGTTTAAGTTAGTGTGCTAATTTCCTAGGTTCTACAAGGGCGTTGCTCCTCTGTGG
ATGAGACAGATCCCGTACACCATGATGAAGTTCGCCTGCTTTGAACGTACTGTTGAAGCT
TTGTACAAATTTGTGGTTCCTAAGCCCCGAAGTGAATGTACAAAGGCAGAGCAGCTGGTT
GTGACATTTGTGGCAGGTTACATAGGTATGACCTGTCTGTCCATGTATATATCTACCTTC
AGGGTCTCACTTTATAACCCTGGCTGTCTTAGAACTTACTATGTAGGCCAGGATCCACTT
GCCTCTGTCTCCCAAGTTAGGGGATTGGAGGTATGTATCACTACACCCTGGCTGGTATGA
ATTATTATTTTTTTAATATTTTTTATTATTACGTATTTTCCTCAATTACATTTAGAATGC
TATCCCAAAAGTACCCCATACCCTCCCCCCCTGGTATGAATTATTTAGAACACATCATGA
AATTATATGCAAATTATATCACTTCCATTGTTGGCCCCTTTGTGAAGGAAAATTTCCAAA
GATTTGGGAGCACTTTTATCTGCCTGTTTTTATGTTCTGCCAGATTCTACATACTCTTAA
TTATTTCCAAAAAATCTTTTTCTATAGTTACCATTATTATTATTCATGTTACTGTCATGC
TTGAAAATGCATCTGTAACTCCACTTCCAGGAGATATGGCTCCCTTTTCTGATCTTTGGG
CATACAAGGCATGCATGTGGTGCACATACATGCATGCAGGGAAGACACTCATGCATATAG
AGTGAGTGAATCTAAATGTAAATGTTTTGGATAATAAGCTAAAGCCAGTGTGGTGGTACA
TGCTCGTAATCCTAGCACTGGGAGGCTGAGGAAGGAGTTCTACTTGGAGGTATCTTGATT
TTTTTTTCCCTTCCCTTTCCCCCAGCTGGAGTCTTCTGTGCGATCGTCTCCCACCCTGCT
GACTCTGTGGTCTCTGTGCTGAATAAAGAGAAAGGCAGCACCGCGTCTCAGGTCCTGCAG
AGGCTGGGCTTCAGAGGTGAGTCAGGCTCCCCTGAGACAGCAGCTCACTGTGCGCGTGGG
GAGGTAGGTGGCGCTCGGGCACTCATGTCTCCTCTCTGAACCAGGTGTGTGGAAGGGGCT
CTTCGCCCGAATCATCATGATTGGCACTCTGACTGCACTACAGTGGTTCATCTACGACTC
TGTGAAGGTCTACTTCAGGCTCCCTCGCCCTCCTCCCCCTGAGATGCCAGAGTCTCTGAA
GAAGAAGCTTGGGTTAACTGAGTAGATACATCAAAGTAACATGGACTGAATCTGCTTGTT
GATCAGTGTTGAAAGTGCAAAGGAACTTTTATATATTTGACAGTGTAGGAAATGTCTGTT
CCTGATATAATTACTGTAGTACCCTTGCTTAAAGCAAGAGTTTCAAACTTAATGCTAAAT
AAACCCATCTATTCCTGATGTCTATGAGTTTGTTATTTTAAAAACTAGTATTGAAAAAAG
ATTTAGTCCTAAAACAAAAAGAATAATTAAGGTATTCACCCCAGGAAAAAAGTGTAAACT
AAGTAAACCATTGGTGCTATTCCTAAATTGTCCCCTCACTTAAGAAACTCCTGTGTTTAG
GAAATAGTCTTGGGTTTTCAAAAACATGGTTTATTAAATATGGATAAACACTGAATTGTA
GTTTTATTTTTTTGACAAGCTAATTTTAGTATAGCAAATTTTTGTCTCATGTTCACTTTT
TAATGCTAGTGGGCCTATTGGTCTGTGTTTGTAAAAGGGCACCCAGATTAGGCTCATTCT
TAAAATGATAGTTAAGGACCAAAGCAGGATTGCTAAAAAGACTAAGGTGACCTACTTTTC
ACACAACCAGACTGGATGGAATGTCAGCAGTTTGCAGTTTTGTTTTTATTTATTTAGTTT
TTTATGGGAAAGGCTGCTAGACAACTGAGCGAAGCTGGAGATGCAGCCTCAGGCATACTC
CTGAGGTTTAGCCCAGCTTTTAAAGCTGCACAGATGTTCAGGTTCCTGCTTGTTTATTCA
GAAATACAAAGGCCCAGTTTATGTTTCCTGATTTTTGCCTTCAAGTTCTTGCTATTTGGA
GAGAGCTAACAATCTCTACATAAGATACACATATAATGTGTGTGTGTGTGTGCGCGCGCG
CGCGCGTGTGTGTGTATAAGGGGAGGGTGTCGGGTAATCCAAGAATTCAGGTGATCCTCC
TGCCTCAGCTTCCTGGGATTATAGATAAGAGCCACTACAGCTTGTTTCTGCAAGAATTCC
AATAGAAATGCTTTCTTTCATTACCAATCTGTTTTCTAAGAACATTGAACCAAGTTTCGT
GTTGTACATTTAGTTAGCTGCATGTTAAATGTACACCTGTACTGAAGTTCTAGGGAGGGT
TATTAGGTTTGAAATTGTTAGGTGAAACTTTTTGAAGTATCCGTTGAGCTATCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1262..1410, 2925..3046, 5262..5441, 6088..6269, 6752..6924, 7645..7755, 7844..8175
1266..1410, 2925..3046, 5262..5441, 6088..6269, 6752..6924, 7645..7755, 7844..8001
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved