Mus_musculus Locus Eef2
snOPY snoRNA Orthological Gene Database
Mus_musculus Eef2
Mus_musculus
Eef2
10
SNORD37
3305..3368
7850
CTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGCCTGGCCTCGAACTCAG
AAATTGGCCTGCCTCTGTCTCTGCTGGGATTAAAGGCATGCACCACCAACGCCCCGCCTT
TTTGTTTGTTTTTAAGATAGGGTTTCTTGATTTAGCCTTGTCTGTCATGGAACTCACTCT
GTAGACCAGGTTAGCCTTGAACAAAGATCTCCTGTCTTTGCCTTCTAAATGCTGGGATTA
AAGGCGTGCACCACTACTGTCTGCCTTTTGTTTTGGTTTTATCATAATTGTTGCATTTTT
GCCCGCAGGAGGATCAGGAATTCAAGGACAACCTCTACAGCCAACCCAGTTGAGGGCCAG
CCTGTTCTATCGAGATCCTGTCTCCGGACAAAAAAAGTTTCATGAGAGCGTGGTGTGTTG
GCACAGTCTTTTAGTCCGAGCACTGACGCAGTAGATTAAGGCAGATCTTCATGATTTGGT
GCGGTCCTGGGCTGCATCCAAAGACCTTGTTTCCAAAACAAACAAACGAAAAAGTGTAAT
AAAAATACAAGCAAGGTTTTGCAGAAATAAATCTGTGGCCTCAAGGGTCCCTTTCTCCAG
CTTTTCCCAGAGGTGTCAAATTACATAACAGTCTCAAACCCAGGAAATTGAACTTTGGCA
CAACCCACTGACCGGTCCGAATTTCAAAGTCTTTTTCCTATTGACCTACAAGGTTTTCAA
GAATCATGTTGTAAGCAACTGTGTTCTGAGGAATCTATGTTTAAAAACCCATCCGTGGAT
CTTGGCCCAGGGTCCAGAGACTGAGCTAGCCACGCCCCGGCCGCGCCGCAGCCACTCCCA
CGGCAGTTCAAGTGTTAAGTCCCAAAGACCGCGCTCTGTGCATGCGCAGACCCGTCCACA
GCTGGCTCCTAGCCAACCCGGCCGGACGAGCACCCGGCGCCGTCACGTGACGCACCCAAC
CGGCGTCGACCTATAAAAGGCCGGGCGTTGACGTCAGCGGTCTCTTCCGCCGCAGCCGCC
GCCATCGTCGGCGCGCTTCCCTGTTCACCTCTGACTCTGAGAATCCGTCGCCATCCGCCA
CCATGGTGAGTCTCCTCGGCTCCGCTAGACTCGGGGACCGAGACGAATCTCTGGGGCAGC
GGGACGTGGCTGTAGCGGGACGCTGAGAGGGACGGGAGGAAGAGACATGGCTGCCCTGGC
CCGGGCGGCAGGACGTGGTCGGGCCGCGGCGCCATATCTGCGCGTCCCTGAGGGCCTTGG
GAGTGTCAACTGCCGAGGTCGGGGTGTTTTCTTGAAGTCCTTCAACTCCCCGCGGCCGCC
GGGGTGACTGCGGGAGGGGTTGTGCTTGGTGATGTGGCAGCGGGCAAAGCGCCGTCCCCG
CGCCCCTGGTGACGGGCGGAGGGTGTCCTCGGGAGGTGACAGCCTGTAGGGCTGGCTTCC
TTGGACACCTCCAGTGGGCTGAACGCCTTCCGGGCCCTTTCCGGTAGCCCCCGTCTCTGT
TTTCTATCTGAGTTCACACGTGAGCACCGGTCCCCATAATCTAAGAAAGTGGCTCACTGG
GCCTAGTGGCGCATTGTGGCCTTTGATCCGGGCTTTGACCTTGGCGCACAGCACCCAGTG
GTTTGGGGAAGAGGTGTGTGTAGCAGAGGAGGTTTTTTCGTGCTTTGGTCCCAATCAATC
CGGCATCTTTGCAGTGCCGAGGTGGCCGTGCACCTTGGCTTTGAATTCTTGTGCTGAGGT
TATGTGACTTGAGCCTCAAGATAGGGTCTTCTAGCACAGGCTTGCTCTTAAGTGTCGCAG
TTGTCGGTTTCGGCGTTTGTTTAGAGCTGTGGACACATCTGTGAACTTTTGATGCTTATT
TCAGAGGTCCTGGGTTGTACGTTTGAGTCACACTGTGAGCTCAGCTCCAATCTTGGGCCG
ACATCTGGTTCCTGCCCCTGCTGTGGGGTGCTATTGACCCACCGATGCCTGCCAAGTTGG
GTTCCCAGAATCAGCCTGGCTGCCCATCCCCCCACCACAGGTGAACTTCACAGTAGATCA
GATCCGTGCCATCATGGACAAGAAAGCCAACATCCGGAACATGTCAGTCATCGCCCATGT
GGACCACGGCAAGTCCACGCTGACCGACTCCCTTGTGTGCAAGGCTGGCATCATTGCCTC
TGCCCGAGCTGGGGAGACGCGCTTCACTGACACTCGCAAGGATGAGCAGGAGCGCTGCAT
CACAATCAAATCCACGTGAGTGAGGGGACAGCCCCGAGGGGTTGTGCTCTGGGTGTCACT
CGGGTGTGTTTGCTGCCAGTGGACAAATAGTGGCGTGTTTAGGGTCCTCTCTGTGACATG
CTTGTGTGTGCTGCCTAGCCTGCCTTGGTCAGATGCTGAATGGACTGTTGACCTCTTCCT
CTCCGTAGCGCCATCTCCCTCTTCTACGAGCTCTCTGAGAACGACCTGAACTTCATTAAG
CAGAGCAAGGATGGCTCGGGCTTCCTCATCAACCTCATCGACTCTCCAGGCCATGTGGAC
TTCTCTTCAGAGGTGACAGCTGCCTTGCGTGTCACCGATGGAGCTCTGGTGGTGGTGGAC
TGTGTGTCTGGTAAGCCTTGGGTGGGAGCTGTAACAGACAGTTGCTGGTGTTTTCATGGC
CCAGTACCACATTTTTGGGGGTGTAAATTGAAATCATATTCATTTTAAGGCAAGGATGAA
TTCTGCTCTAATTTGAAATTGTATGTGCCAGTCCCCATGTCAGGGCAGGGAGATTGTGAA
GTCCACCTAAGTGTGGGGCCAGTTTCCTATAATTTCAGTGCTCTGAGGCAGAGGTGCATG
GGTCTCTGGAGGTGGGAGGGGCTGAGTGGCATAGGGCCTGGTACACTGGACACACTTGGA
GATTTAGCGCCTGGGCATCCATACCGTGTACCTTGGAGAGTGCTTGTGTACATTTCACAG
ACAAAACATACGTGGTCTTCAGGCCTTGAACTGTCAGTGGTTTAGAGTACTTGAGAGTTA
AGGGTAAACACTTAGTCCTTTTCACCCTGTCCTCAGGCGTGTGTGTGCAGACAGAAACTG
TGCTGCGCCAGGCCATCGCTGAACGCATCAAGCCCGTCCTGATGATGAACAAGATGGACC
GGGCCCTGCTGGAGCTGCAGCTGGAGCCCGAGGAGCTCTACCAGACCTTCCAGCGCATCG
TGGAGAACGTCAACGTCATCATCTCTACCTACGGCGAGGGCGAGAGTGGGCCCATGGGCA
ATATCATGGTGCGAAGCTCTTCTATGGGGGGCGGTCAGGGCCACGCTCCCTGGGAATCTC
TGACCCACCATGATGACGGAAATTCTTCACTTTGACCTGATGTCTGTTGAAGAAACTCAG
TGTCTGAGACTGTGGGCTTGTGGCTGGGCTGGCTGCTGACCATCTTGCCGGGCTAACTGC
TGCTCTCCTCCCTCAGATTGACCCCGTCCTGGGCACCGTAGGCTTTGGTTCTGGCCTGCA
TGGCTGGGCCTTCACCCTGAAGCAGTTTGCGGAGATGTATGTGGCCAAGTTTGCAGCCAA
GGGTGAGGGCCAGCTGAGCGCAGCCGAGCGTGCCAAGAAAGTAGAGGACATGATGAAGAA
GCTGTGGGGAGACCGGTGAGTACATGGCTGTGTGACTGTCTCTACCCCTGCTACTTGTGG
ACAATGCCTGCCTGCCGATACTATGTGACTGCTCTCTACAGGTACTTTGATCCGGCCAAT
GGCAAGTTCAGTAAGTCAGCCAATAGCCCAGATGGGAAAAAACTTCCCCGCACCTTCTGC
CAGCTCATCCTGGACCCCATCTTCAAGGTGGGTAAGCTGTGGTCCTGGCCTGTGTTCCCA
GCCTTGGGAAGTCGCTCCCATGACCTGGCCTTGCTCATCTGCTTCCCTTGTGCAAACAGG
TGTTCGACGCCATCATGAACTTCAGGAAGGAGGAGACAGCCAAGCTGATCGAGAAGCTGG
ACATCAAGCTGGACAGCGAGGACAAAGACAAGGAGGGCAAGCCATTGCTCAAGGCTGTGA
TGCGCCGCTGGCTGCCTGCAGGGGACGCCCTCCTGCAGATGATCACCATCCACTTACCAT
CCCCCGTCACTGCACAGAAGTACCGTTGTGAGCTGCTATACGAGGGGCCTCCCGACGATG
AGGCCGCCATGGGTATGTACTGTAGGGGCTCCTGGGCTTAGCTCTTGGGTCCTCCAGCCT
TGGCAACCAGGTGACTCGATTTCCCAACTTTCCATAGGTATTAAGAGCTGCGACCCCAAA
GGCCCACTTATGATGTACATTTCCAAGATGGTGCCAACCTCTGACAAAGGCCGCTTCTAT
GCCTTTGGTAGAGTGTTCTCTGGGGTGGTGTCCACGGGCCTGAAGGTCCGGATCATGGGC
CCCAACTACACGCCTGGGAAGAAAGAGGACCTATACCTGAAGCCTATCCAGAGGTGGGCA
CTGGCCTTATTTTCCTGAGTCCTGGCTGCTTCCCAGGAGCACCCTGTTGACAGTTGCCCT
CCCTCTAGAACCATTCTGATGATGGGCCGCTACGTGGAGCCGATTGAGGACGTGCCATGT
GGAAACATTGTGGGGCTGGTCGGAGTGGACCAGTTCCTTGTGAAGACGGGGACCATCACT
ACCTTTGAGCACGCTCACAACATGCGCGTGATGAAGTTCAGCGTCAGCCCTGTCGTCCGT
GTGGCAGTGGAGGCCAAGAACCCAGCTGACCTGCCCAAGCTGGTGGAGGGGCTGAAGCGG
CTGGCTAAGTCTGACCCTATGGTGCAGGTGTGCCACTAGGTCTTGGCTTATTGTGGTTGG
AGAGGGGGAACACCTGGCAAAAGCAGGGGAGGGCTGAGGCTAGGCCTGTATTGGCTGTTG
TCATAGGGCTGAGCCCTATGCCTGGGGAGGACGGCAGGGTGCTGACCATTGTTCCCACAG
TGCATCATTGAGGAGTCTGGAGAACATATTATTGCTGGCGCCGGTGAGCTGCACCTGGAG
ATCTGCCTTAAGGACCTGGAGGAGGACCATGCCTGCATCCCCATCAAGGTGGGCACCAGA
ATGGGCGTCTCATCCTTCTGCCTATGTGCCTGAGGTGCTGCACCATGTGCTGAGGGTTCT
ATGCAGGCCCCCTGGAAGCCCTGTAGTGTTGACAGTTGTGGTCTGTTTCCCTTTCACAGA
AATCTGACCCTGTTGTGTCATATCGGGAGACAGTCAGTGAGGAATCCAACGTGCTGTGTC
TGTCCAAGTCCCCCAATAAGCACAACCGGCTGTACATGAAGGCCAGGCCCTTCCCTGATG
GCCTGGCAGAGGACATCGATAAGGGTGAGGTGTCTGCCCGCCAGGAGCTCAAGGCACGTG
CCCGCTACCTGGCCGAAAAGTATGAGTGGGACGTTGCTGAAGCCCGCAAGATCTGGTGCT
TTGGCCCTGATGGCACTGGCCCCAACATTCTCACCGACATCACCAAGGGTGTGCAGTACC
TGAATGAGATCAAGGACAGTGTGGTGGCTGGCTTCCAGTGGGCTACTAAGGAGGTAAGTG
ACTCAGCATTGGTGACCCTGTGTTCTGAGGGGCTGCTGGTGTCTAACTTCCAGCTCTTCA
CAGGGCGCTCTCTGTGAGGAAAACATGCGTGGTGTGCGGTTTGATGTTCATGATGTGACC
CTGCATGCTGATGCCATTCACCGGGGAGGTGGCCAGATCATCCCCACAGCACGCCGCTGC
CTGTATGCCAGTGTGCTGACCGCACAGCCCCGCCTCATGGAGCCTATCTATCTGGTGGAG
ATCCAGGTAACTTGTGTATCTTAGGTGGTGTCTGTCTATCCTCCTGCCTCTGCCCACTGC
TCACCATGTTCTCTCTTTTTCCTCGAAGTGTCCTGAGCAAGTGGTGGGTGGCATCTACGG
TGTCCTGAACAGGAAGCGTGGCCATGTGTTTGAGGAGTCCCAGGTGGCTGGTACCCCCAT
GTTTGTGGTCAAGGCATACCTGCCTGTCAATGAGTCCTTTGGTGAGTGTCTGGTCCCTGG
GGTTTGCAGATAACCTGCAAGGCCTGTGTAATATAGCTGCGGGGTGCAGAACAGAAGCAG
ATTTCTGTCATCACGGCCAGCTTGCTTAAGGGTGCCAGGAAAGACAGAGCTACAAACTAC
ACAGAGAAACCAAAACAAAGGACCCAGGAATCCCTCCTGGGAGGGGTGGCAAGACAGCTA
AGCATGTCCCCCCCCCACCCCACCCCCCCAGGGAAGTCACCTGAGTCTCCTGTCTTCTGT
CTAGGCTTCACCGCTGATCTGCGATCCAACACCGGCGGCCAGGCCTTCCCCCAGTGCGTG
TTTGACCACTGGCAGATCCTGCCTGGGGATCCTTTTGACAACAGCAGCCGCCCCAGCCAA
GTGGTAGCTGAGACGCGCAAGCGCAAGGGCCTGAAAGAGGGCATCCCAGCGCTGGACAAC
TTCCTGGACAAACTGTAGGCAGCCTGATACTGCCACATGCTGCACAGTGCCCACCCATCA
GAAGACACCTTGAGACTGTCCCACAGTGCTCCTCTAGAGGCTGCTGGGGCCACCCTGACA
TCACTCAGCACTCACTTGCTACCAATTCTATTTATTTCGGAATTACAAGATAGCGGGAAT
CTCTCTGCAGGCTGGACTGGCAGGCTGTGGGGTGGGCGGGACACGGCTCTTAACATTTTC
AGAGGGAAACGCGCAGATGTCCAAAAGTCTAAATAAATGCATTCAGAGGTTTTTGGGGTC
CATGGCCAAGTGGAGTTCCCCCAGAGGGGGAGGTGGGGTAAGTGCCTCCAGGAAGGCAGG
CAGCCTGCCTTAGACTTGCAGCCCGGCTGTGGGAATGAATCATTGGAGTAATAAACTACA
GTGGTTGATCCACATGTGCTCGCAACTCTGTTTTGTACAGCGCACGCTTTCCTGGTTTTC
AGGGTATCTGGCTACCCTTAGGTGGCCTGCGGTGATTCACACATAACACACACACTGCAC
CCCGTGCGACAGAATGGGTTTTATTGTGAGTTCACAGTACTGCCTCAGTCCATTCCACAA
ACTTGAATCACTCCATAGACCTGCACATCAGGGGTTTGGTCTGCGCATACCCGGCTCCAG
GTTATTGGCTTTCAGCCTCTCGCGTTAGCCAATCATCAGCCAGGAGCCCAATAATGATGT
GCTCCACAAGGGCGGTGTCGAGCCTTCCTGTGAATCTGTCAGGCTGGCCAATGAGCACTG
GACTCTCGCCTAGCCTTGGGTGATGACGTCACTAGTCAACGTCCGCTTCCGCTGAGAGGT
CAGATGCTAACCAATGAGCGTGTGCATTCAATTTCCGGTTAAAGTCGTAGTCCAATGAGC
GCTGGTTTTCGGGTTTTGCGGAGGTGTGCCCCTGCGCTGTCAGCGCATGCGTAGATGCCG
TCTCAGGATTTGTACCGGAGGTTCTCGCGGGGGCCTCGCTGGCACCGGGCGGGGACTCGA
TGGCTGAGGACGGTACGAATGGGCCGGGTCCGGGACGTTGTGTTGGGACCCAAGGGACAC
GCGACGAGGGCGGGAGCGAGGGGAGGGAACCCGCGAGGGGCATGGCTTTCTCCAATCTCG
AGGGGTGGACCTCTAGGAATAGCAACACTGCTGCGCATGTGTCAGGTTTCCGGCGACACC
CCTGAGTTCCGGGGTGCTGGTGGGCATGATTGACAGGTGAGGAAGCTAGGTAGGAATTTC
AAGAGCCGGACGCTATGGAAGTGTTTCGAGTAGAGAACCCCACGCTGACTTGGAACTCTG
TTTAATCCTCCAGCCTCAGCCTCTTGAGTGCTAGGGTAAAGGGCACCTGACACTGTATTG
TGTTTTATAGTTTTGTACATATATATATATATATATATATATATATATATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 2020..2234, 2408..2589, 3036..3247, 3436..3614, 3701..3806, 3899..4151, 4237..4432, 4508..4766, 4920..5027, 5159..5512, 5583..5765, 5848..5980, 6244..6850
1082..1084, 2020..2234, 2408..2589, 3036..3247, 3436..3614, 3701..3806, 3899..4151, 4237..4432, 4508..4766, 4920..5027, 5159..5512, 5583..5765, 5848..5980, 6244..6434
NM_007907.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved