Mus_musculus Locus Rps12
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps12
Mus_musculus
Rps12
10
SNORD101, SNORD100, SNORA33
1658..1731, 2378..2451, 2726..2854
4016
ccgtctctcatctttaaaacagcaccatagacactggcagaaatacgcccacagaaact
aaccacctattaaatacttttttgaattgcaggggtaaggaagcaagcatgaggctttag
gggtgaaacccaaacgtttattggaaaagctaaaacttccatcaactttcttatatcctc
atgaaattcatgagcccgacaatgatcactgtatccaccaggttggccatcagaagctct
ggttggcttcggggatatcttctgagagagatgtcttgtgtatttgctttggaagtagaa
gagcgagtgattccttcgaaattaaaatgcatttgtcggcgtaggcgggaactggcttta
agattctggagttccactcctggtagccgaatcctcggtggaatttagtgacagatccac
agtgagagtttaacatgtacctcagggatccagtgtctgcgaagctgcgactcgggaaaa
aaactagggtcattacctaaatgttcattcagaaccggttgcattcagaccgggatctga
cctggccgcaaggtctgcttaaacacgttgcaaagcagtggggtttgtgatcatacacaa
atcacagccactcagagaggctaaaaaccaaaggaccaaaatgtggacacactcagccta
atcggccagtattggcaacaggaaacttcacgataagacgtggaaaaactgcttaaaaca
aagtaattcagcagcgaagaaaacggcagtagtttggctcctctcgtgttccgtaggagc
ggatcgtgggacctctgtggtccacgccccctgggcaaaggctgcccgctgcgatgcctg
ctagaaatccagccgcgttcttaccacggacgctcctaaaggcggaagtggaaactccta
aggcacggcaccaccggagccacctctttagtgggaggagttgcacatgcgcacagaagt
cgagcggagcgcttaaataccgtcatgcggccaccgccggccttttcccctgccgccgcc
gacttgcgcggaggcggaagctcggggtgagtgtgatcccagctcgtgcgccggcgatag
cgtgtctactgcgccttggcttcaaaagtgaagtacttgggtcttaacgggcgatttact
gatgttttgtctttcagtgcgttcaagattcggcgtcacccgtgattcaccgccatggcc
gaggaagggtgagcgagtggggcgtgggcctcccgcgggcggcgctggtctgggcttttc
tccatgctagttccccatccctagcctgccgagggtcctaacgtctctgtctgcattcca
gcatagctgctggaggtgtaatggacgtcaacactgctctacaagaggtgctgaagaccg
ccctcatccacgatggcctagcacgtggcatacgcgaagctgccaaagccttagacaagt
acgtgtctcagtctcaatactgtggggtgttgcagccggaacaaagactgcagcagccaa
gggaagagagcgtgaagttcatgctgttagcacaaaagttctgaatgtcatccggccagc
aggaaacctaggaaaaggtatcaactctagcccacttaggatgtgtgggttgctgtgtgg
atcggggatgacgagcagtagttttgtaaagctacagtgtttgcatgatgacttgaattg
tcggataccccttcaccccgttcatgggtgagaaacagctagtctgacaaacctgtagct
cgtggggatagatagtccggtagttttgctagaagatggaaaaggggggggcatcattat
ttagtttgcaaatacttaaacgacaatattgtggtgtcggggaaatctagctatatccgg
gagacttgagaacatgcatggtttattaggcttatgcacgtgtattctactgtttgaggt
aaagtcaggtgattttggatgctgttgtgaatatttacagtgcttcctgcacaggactgc
tttggatcagctttcaagttggaaataccctgaaagtggtcatagtttcctttggccata
aataggtttcctattataatgtgtggtattggtatctaagtttgtacagggaaagtgaat
ggctagtctgcagtttggtacagtaaatcctgtgtggtcaggtttactagcacagtgaag
acccttgaaggtttcacctttgagttttgcattttaggcgccaagcccatctgtgtgtgc
tcgcatccaactgtgatgagcccatgtatgtcaagctggtggaggcactttgtgctgagc
accaaatcaacctgataaaggtaagccttagtgataatggtgttgagccacaggcaccag
cactaacttgcatggtagttttgatgattttcacgtgggctgtacatgatgaaaacagtc
tccctcttctgaatctcgctgaggaaactgcacgtcaccctcctgaaacagccaccctgg
gaatgttgagggtcagcttttactagtttcaatccttgttagtaattgcttttgtctttg
ataggttgatgacaacaagaaactaggggaatgggtaggcctctgtaaaatcgatcgaga
gggcaaaccacggaaggtggttggttgcagttgcgtagtggttaaggtaagtcttgcttt
tctctttaaaatgttgatggccctttagtggaaacaagttttaaagacaagatttaaacc
ttctgtaaagataagccatcatttgaaagccagccaattaatctgcttatctcaatgttt
ctgcagaaatttagaaagggctggcaatattaatgccatggtacgagccttaggggcagc
tgaagcctttaaggtccctgaaagtggctacagtattattgggaagactgaatcaaatag
ctgatcggaatttaatactgaaagtaattcgcatttaatttttttaaggactatggcaaa
gaatctcaggccaaggatgtcatcgaggaatacttcaagtgcaagaaataaataaatttt
ggctgatttttctcttgtatttcttgtttgctggtataaaatgggatgtgcttactcagg
tgatagtggattggaagtacctgtctgctcttactattttcgttgggtaaatgactgcca
aggctacatacacaactaaaattgggctttgggcttagtatttttgatggacaaaggaga
cgcatcaaagctttaaactggagaacacaggcctcagaattaggcacactgggcagccag
aactatagataattgctaaaatttctggttacatgccatgacaggttgagaggtaaatta
cactgagtagatatccagggttggtaataacggtacaaggttagattggggtagaaagat
ggattagagggttaagtgtgggggaagatttgggactcaggttccccaggggtaaatgta
gacatgcttaaatttctgaaccctgtttgcatccaagtcctaattttctagtgttctagt
tggttagaaaggcttagaaatctgtagtgatgagggattcttaagcagcgttatgggaca
gtttgcatgaaccttctgttgctagcacttagtgacagttaaaaatatcagttgtagttt
tgctttcaaagtgtctggttttaggaaatgtgtcaaggaaactatttgatggtatagtgt
atccataagctgttagcctttttttagataaagcaagaaactcaagaccttcagaaaaga
actagaccagctacaagtgtgctaacaataacttctggagtcaacttgggatgttcaagc
atcaagctcaggttagatttggcagtaagcacctcccaatgacttgtgggaatatttgag
gtgtgtgcagtctgtcagcagagggtaggaggctaaggctggcaccatgttcaagatgtc
tccaagggaatgggatggagctgtgctgcctacagttacttgggaaagagactttaggaa
tcctgtgaaaggagaggaaaaaagcttgttaaaaaatgtagggggggcgccttgtgt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1157..1207, 1321..1437, 2197..2299, 2524..2625, 2928..3016
1194..1207, 1321..1437, 2197..2299, 2524..2625, 2928..2990
NM_011295.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved