Mus_musculus Locus Rpl10
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl10
Mus_musculus
Rpl10
X
SNORA70
2628..2764
4278
AAGAGGCACAAATTCATAGAGTCTGAGTGACTGATGATGCTCAGACACGTGCTCCTAGA
TCAGAACAGTGTTCCCGTTCTGGTGCCTCCCTAGATTGTAACCTTATATGGGAGAGTAGT
TAGTGGTTAGCTGCCAATCCTTCTAGACACACCCAGATGTACATTTTGAATTCTTCATAG
TGAAAAGAAGAGGTGTGCTACACCTAGTTTTTCTCTCGGAATCTGGGGCAAAGGAACTCC
GACTCTCCTACTAGGGCGTGGCCCACAGCACCGCGACCCTCCTGGGGCTAGTAGGAAGTA
ATGATATCGCCATCGTCTTTGCCCAGTCTCCAGTCTCCCTAAGAACACGTCTTTTCCTGA
GAATTAGAGTGGGGCGGGCCCAACTAGCGAGGAGGACAGTGAGCGCCTAACGGAGATTTT
TTTCCTCTAAGGGAGATTTTAATTGGTCTCCTGAAAGCAATCAAGCACCTATCATGGTGC
TCTTTGTTGGCTCTTAGACGTCAGCTTTGTGGGTGGGTCTCCAACCTCCCGGGTGACAAA
GGAACTTCGGAGTCCCTACCATGGAACGTTCGCGCCATTTCCTGTAGCCTTGAGGAAGGC
CTGAACCAGCACTCTAGAGCCCTGTAAGCAAAGGAACACCTCCGTGACGGTCCAGTTCCA
CTGAGAAAGACTCCCCTTTTCAAGTCTTAGAATATTGGCAATCATACGTAATAGCAAAAC
CTGTCAATGGCTCTCCGCCCAATATGGCCAGGCGGAAGCTGGTTTCTCTTGCCTATGTGT
CGAAATCCCATTCGCCAGCATGCAGTTCCCTATTCCGGTATCCAGTCACCAATAAGCTCT
GTGCTTCGTTCGGTCCCGCCTGGTACACATGCGCAGAGCAGCGCTGCATCTATGATCTTA
GCGTCTGATAGAGCGTCGACACCACCCCCTGGCTGTAACTCTATGGTTGTTACAGTGGAA
GATAGGCCGCCTATATAAGGCGTGAGCAGGCGTGGGAGCGTCTCTTTTCCTCTGGCGCGG
TGAGTGAGTTCGGTCACGGTTTTTTACGATGGTCTCGTAATTTTTCTTTGGGATTTTTTT
TACACTTATTCTGTGTCTGTATTCTTTGACTGTTTCATTACAGCCACCGACGATCCTATT
GTCATCATGGGCCGCCGCCCCGCCCGGTGGTGAGTGCTGAACCCATGCAATCTTCCTACT
GTGAAAACTGAGGGAAAAATGCATTTCTTTCGAAAGACTTTTTTTTTATGGGTGGACTCT
CTGCCACTTAGAGACCCTGAAGTAAAGACTGACTTCGGGTTTTCTTTAATACTTTACTGG
GACCTTTATTTTGAGGCTGTGGGTGGCGTTACCCAATACTAAAGCGCTTGGGTAGAACTA
GCATGTCCGTGTGCATCCAATCCTCTGCGTCGCAAATGAGCCTTTTTACAACGCCTACCA
GGCCTTCTTGGTCACTTTTGCGTCCGTCTTTTATTTCCGGCCTTGAGCTTTGTGGTTTTT
AACAGGACACCAAGGGCTGACCAGTCCGTAGGCGCCGCCTAAACGCGTGTCCTGAAGAGG
ACGCCATATTCTCTTAACGTGGCTAAGGCGGGTCTTCTGTCACATGCTAGGAAAATTGTG
ATATCTCACCCAACTCTGGTTAGAGGGTGATGCTAGTGCATGATTCTTTTTCTGTTTTAT
AATTTGTGTAATTGTTTAACAACAAGTTGCCTTAGAATCAGTTACCCTGAATGGAAACTG
GATTCAGAGCTGGTTTAGTCCTGTTGTCACCATTAATCACACCTGAGTTTCCTTCCTTCT
ATAGTTACCGGTATTGTAAGAACAAGCCATACCCAAAGTCTCGTTTCTGCCGTGGTGTCC
CTGGTAAGTAGTGACAAACTTCGAACTGGATCGGTGTTTGTCTATTCCCCACTTCTCGAG
AACTTTAAACCACGTGTTTTTCAGATGCTAAGATCCGAATCTTTGATTTGGGACGGAAGA
AAGCAAAAGTTGATGAATTCCCACTTTGTGGCCATATGGTGTCAGATGAATATGAGCAAC
TCTCTTCTGAAGGTGAGACAGCTCCCATTTGTTAATTGGCTCTTTTTTTTTTTTTTTTTG
GTTTTTCGAGACGGTTTCTCTGTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGG
CTGGCCTCAAACTCAGAAATCCACCTCCCAAGTGCTGGGATTAAAGGCATGGACCACCAT
GCCCGGTGTGTTAATTGGCATTTCTTGTGTACTTGTGGATTATATATTATAATTTATTCA
ATGTCCTGACACCCTGTTTCACTGCTGTTATTTCCCCATTCAGCACTGGAGGCTGCCCGT
ATTTGTGCCAACAAATACATGGTAAAGAGTTGTGGCAAGGATGGCTTTCATATCCGAGTG
AGGCTCCACCCTTTCCATGTCATCCGTATCAACAAGATGTTGTCCTGTGCTGGGGCTGAC
AGGTAAGCTGGTGTTTTATTTGGTTTTGAGACAGGGTTTCTCTGTATCCCTGGCTGTCCG
GGAACTTAATGTACACCAGGCATATCTGAGATCTGCCTGCCTCTGCCTCCCAAGTGATTA
AAAACCACCACTGTCCAGCAGTATTTTTAGGGATTTCTTTGATTTTTTGTGCAGCTAATT
AAGCCGACCAAGTCCCCTTTTCCCATGGGGACTTTGGTGTGCAATGGTTGCAAACAGCAG
CCTCCTTGGTAGTGTATGTAGCCTATTATCTATATGGGCTGCCTCAAGGGACCTTGGAGA
CAATTTTCTGGCAGTTGGTAATCAGGCCTCTGATCACAATGTTGTCCCTGATCTAGGCTC
CAGACAGGGATGCGTGGTGCCTTTGGGAAGCCCCAGGGCACAGTGGCCAGGGTTCACATT
GGCCAGGTCATCATGTCCATCCGAACCAAGTTGCAGAACAAGGAACATGTGATTGAGGCT
CTGCGAAGAGCCAAGTTCAAGTTCCCTGGCCGCCAGAAGGTAGGTAGTGGTATTTAAGTT
CTTCTGTTTTCTTGCTCTGGTCCTCCTTGCTGAGTTTGTTATTTTCTATTTCCTTCTAGA
TCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTTAATGCAGATGAATTTGAAGACATGG
TTGCTGAGAAGCGGCTCATTCCTGATGGCTGTGGTGTCAAATATATCCCCAATCGTGGTC
CTCTGGACAAGTGGAGAGCCCTGCATTCCTGAAGGCTTCAATAGTTCTCCTATACCCTAC
CAAATCGTTCAATAATAAAATCTCGCATCAAGTTCGCTTATGTTTTTGTTTCTGATTCTT
AAATACCATGAGGTTTTAAATTTGGTCAATTGGGACAGCTTATTGAATTAAGCATACATG
CAAAAGGTTAAAATGATTTTATTGAATATTTTAAACCTGACAACACTGGCAGAGCCATGT
AGTATAGTGCATGGAGAAGCAAGATTACTTAGACCTAAGGTTTTTCCAGTATGAGCTCAT
TTGTATCAGTTGCAGAAATCTTAGGTATGATCTGAGCCCATTTCTACTGGAGCTTTGTTC
CTAACTACCTCAGGTGAAGTCCTGTCTACCCAACAGGATTCAAGCCCAAGGCACTTGTTG
CTGAGTTATACTCCCAGCCCTAGCTTTCTCAGAATAGCAAGCAGCTATTTAAAAAAGCTG
TCATTGACTTTCACATCTGAGACTACCAGTGCCCTGGTCAAGTCAATGGCTATCTAGTCC
AGCTGAGATGGCAGGAGTGACAGCAGTAGAGCGGCTAAGTAGTGGGGTGGGATACTCAGT
GGAGTGGCCTGGCTCAGTTCCACTTCTACAGGATAATGGTCACTGATGCGGAGAGCCTGA
GGAGAGAACAAAATGAAGTGTCAGTATCTGGCTCACCTCCACAATTCTGCCCTCAGCCAT
TTTGCCCACCCAGCTTCTCTACCTCTTCCTCAGTCAGCTGAAACCTCTTGGGAAAGTCAA
AGGTAGCTGCAGCCTTCAGCAGCATTTGGCAGCCCTGTCCATGCACCACAATTCGGTCAT
AGGTACAGTTAGTACTGGCCCGCACTGTAGTATCCTCCCCATCAGGAATCACCCAGTGGA
AGCCTGCCTTAGTCCGGAGTAGCAGGCTTTTCAGACGTTTTTTTGTCAGCGATGCACAGT
CTGCATTGAAGTCTCCAAGCAGAATCACATTCTAGAGACGACAGAAGCCACTGCGTCTTG
CTAAAAGGCATTTGCACCATCCCCTCTGCCATGGAATCTATCACCCCTACCTCATTCTGC
CAGCGCTGGTAGACATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1123..1168, 1804..1862, 1944..2051, 2323..2461, 2816..2978, 3059..3278
1146..1168, 1804..1862, 1944..2051, 2323..2461, 2816..2978, 3059..3208
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved