Mus_musculus Locus Rbmx
snOPY snoRNA Orthological Gene Database
Mus_musculus Rbmx
Mus_musculus
Rbmx
X
SNORD61
2518..2588
9007
CAGCCAGACAGGAACAGAAAAAGAAAAAAGGAAAAAGGAAAGAAAAGAAATGAAAAGAA
AATCCCCTCTAGGTTAAATTGTTATTTTTCTTTCACAAGCAGATAAAAATTTAGAATGCA
GAACCTGGTCTGGTAGCTCATGCCTGTAATTCCAGCACTTGGAAATCTGAGGCAGGATCA
GAGCTGTGAATTCCAAGACCACTCTCAGCCTGACTGGTACTGTCTCAAAACACAAAACAA
ATTAAGAATGCTCACTTAAAGTTCAAGCATGCTTGGTAGCATTTTTTTTTTTTTGTTTGG
TTTGGTGTTTGAGACAGACTCTAACAAAGCCAGTCTGTGCTGAAACGCGTAACTGCCCTA
CTTCAGCGTCCCAAATACTGGGATGAAATGTGTGGGTAAGCACTCCCAACTATCGTCAGG
GATTTTTGTTTGACAGTCTTAACCCCGAGGCACCTGACTCTGGTCTCACTTGCACAGAAA
TCAAGTAGGTACTCAGTAATCGTTCTATATGAATGATATTTTTGTAATGTCATCAAGTTC
TGTTTTCACTTAACACTTACTTAACAGATTCTTCCAATGTATTACTTATTGCTCAAGAAA
ATTTAGCCAGTTATTGAGTATCAACGAAACTTCTTTGTTTCTTATTTCTATAACGTTGGC
ATTCTACCGTTTTTTCACATTGCTTTTGGAATTAGGATTTTCATGCAAAAGTAAAAGTTT
TGCGCCTTGTTTGACCTAATAGGTTGCTCAATAAATTTACTTCTCTAGTCAATAAATCCC
GTCCAGTGTTTTAGCATATTTAGCGAAGCTAAAAGGCGCCTTGGAGGAGAATGGATGGGG
GCAGGGCAAACGGTTAAAATCCGGCACCGGCCAGAACTTTAAGAGACACAGGAAAGAGGC
GGAGTGACTAGTGAATGACAAAGGGAACAGCCAATGAAGAATCTGGGAACCACTCCCTCC
CCTCCCTTCGTGCTTCAAATTCTAAGCTTAATTTCCATCCGGGTTCTTCAGCCTCGTTCC
CGGGTAGTATAAAGATTGCAGTCTCCTTTGTTCGCCCTCGTTGCGCAGTCGTCCTAGCGT
CATTTCTGTTCCGTTCTGAAAATCGGTAGCTGTCACTGGTGCGGCGCTGCTCGGGAGGTC
CGGTCGGCGAGCTCAGAGGAGCTTGAGACCGTCGCAGTCCCCTCGGGTAGGACTTTCCTT
TCCTTGGCCTGTTTTCCATACAGACTTGTTAGAGCTGGATGTCATTTGTTTCCCGGGAGA
TAGTGGCGGCGGGCGCCATTTTAAGACACCCAAAGGTGTCAACCTATTTAAAGCAGAAGG
GGTGGAAGCAGCACATTATGGGGTCAGTTATCTGAGTGCGTCTCCCGGAGGTTTGGCTGT
CCCCTGTCGCGGGAGGGCGGAGGGCGCAGCTTTGTAGGTGGGGCGGGACGTGCTGGGACC
GCGGGAGTAACACCAGAATAGCGTCCGTGCTAATGATAGGCTGGTGGACTTCTGAGGCTT
CCTCTGGTCCTTGGCGGCAAGGAGAGGAAGCTTTCTGAGTTTTCGCTGCAACTGTCAATG
CAAAAGTTAGTTCGTCCGGAGGCTGTTGGTGGTTCTGGGTTCGTTCCAAGTGTCGCCATT
TTGTCTTTAACACGCGGTTTTTAATGAGTCTTAATTAGGTGTCAGGACTGGAAAAGAGTG
TTAAGAGTGTGTGATTCTGAGTTCCGTTATCTTCGGACTCTGGCACTTTTTCTTTTCGAT
CGGATAACTAACAATCTTTCGTTGGGCTAGATGCAGCGACTTTGTCCTAAGGTAGAGATT
TGTCCCTAAACTTAACTAGGGAATCTAAATGTGGAAAGGGCTTGCTCCTTACTTGGTGTG
TCTGGCTGGTGACCTTGAATGAATAGGAAGTCTTTTATACCTTTGGCTTCGGGTTGGGGG
CGGTGGGGCGGATAGCAAGTAGGTTGATAGGTAACGGAATGTTTTAAAGATAAGAGATCA
AGACCATAGCCAGGTGTGGTGGCCCCCTTCTGTTAATTCCTGCACTCTAAGGTTGCAATC
TTATATTAAAAGTAAAATACATTTAAAAGTAGCCTTTTTAAGTGTTGAGTAGCTCTTCAT
TGACTAAAAGCAGGGCAGATGAAGATGGTAAATTAGGCAGGCCCTTTTAACCCTGTTAAT
GAAAATTGCGCTGCACTGTTAGCCAAAGTATTTCAATTGATTTTCTACCACACTTGAGGT
TTATTGGTATCTTTAGTTACTAAAGAATAAAGATTTTAACAAAACATGAGCCATAATTAA
GCTGTTCAATAAACTTTGGGGACTTTCTACAGAGAGATAATAATACCATTTTTCAGCAGA
CCCCCATCGGTTAAGAGGAAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTTATTGG
TGGGCTTAATACAGAGACGAATGAGAAAGCCCTTGAGGCAGTGTTTGGCAAATATGGACG
AATAGTGGAAGGTGAGTTATCTAAAATCGTATGATATATTAATAAAATTAAAAGACAAGC
TGTGATGAATTTGAATCCACTGATCTTCCGACATGATAAATGCATTGTCCTCTAAGAAGT
TCTGAGCTTGCTTCTCGCAGATGTGCGCTGATTATCTTTGTTTGAATGAAACTAAACCCC
ACCCCCCCAACTGTTTCAGTTCTTTTGATGAAGGACCGAGAAACGAATAAGTCAAGAGGA
TTCGCTTTTGTCACTTTTGAAAGCCCAGCAGATGCAAAGGATGCTGCCAGAGACATGAAT
GGAAAGGTATGATTGTCTGCTTAATAAAAAGGTGTTTCTTAGTGACAAAAATAACTAAAA
AGTGTTATCTAAGTTTCAGTCCAGCAGAGCTCTGAAATTTTTATTTTGTGTATGCATGCA
TATTAAGAGACTTCTGTTCACAGACACTACTATCCTGAATTTTATTTTATTGGTTTTTTT
TTTTTTTTGAGTCAGTCTTGACTCAATGTCTTTTGTAGTCTTGACTAAGATCAGGCTGAC
CTCAAACTCACAGATCTTCCTCGGTGTGTCAGAAATAGACCCATGCCCAGTCTCTAGACT
GAATTTTATTGTGATTCCACAACCAAATTTTGTGGCTAATGCTAAGGGTTATTTATTTTT
TTTGTTGTTTGTTTTTTTTGAGACAGGGTTTCTCTGTGTAACCCTGGCTGTCCTGGAATT
CACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCTGAGTG
CTGGGATTGCATTTCAAGTGTTGAGGCATGCACCGCCAACGCCTGGCCTGAACTAACTTT
GTTAGGCATATAACCCTTAGCATTAGCCGGGCGTGGTGGCGCACGCCTTTAATGCCAGCA
CTCAGGAGGCAGTGGCAGGCAGATTTCTGAGTTCAAGGCCAGCATGGTCTACAGAGTGAG
TTCCAGGACAGCCACAGCTATACAGAGAAACCCTGTCTCAAAAAAAAAAAAAACAAAAAA
CAAAAAAAAAAGTTAGTTCAGAGCAGTATATGATGATGTTATGTGATACTGTGTATATCT
TAGAGCACATAGCTCCTTTTATTTTGGTAACAACTTGAACACCTACTTAGACTTTTATTT
CCCTTAGGAGTAGAATAGTGAATCTCTTGCATGTAGTAGAAATTTTAAATAAATGGAACC
ATATTATCTATAGAAATAGTATTTCCACCATTTCTCCTATGATATTTGGCAGATAAAACT
TTTGGAGTCACAGGGCATAGTGGAACTTTTAAGGGTTTTTTTTTTTTAATCTTGATACAA
TTTTTTTTTTTTCTCTTTGAAGTCCTTAGATGGGAAAGCCATCAAGGTGGAGCAAGCCAC
CAAACCATCATTTGAAAGTGGTAGACGTGGACTACCCCCACCTCCAAGAAGCAGAGGCCC
TCCCAGAGGTCTTCGAGGAGGAAGAGGAGGAAGTGGAGGAACCAGAGGACCCCCCTCCCG
GGGAGGACACATGGGTAAAGATTGGAACTCAAGCTTGGTGTTTTAGGTTAGTGACACTGG
TGTGTGCATTCTTTTCAAAGGCTAAAGCCTTTGAATGGAAACTGCCCACCATGCTCATCA
CATTGTTAGTGTGGTGCTCAGGACTTGAAAGGAAGATGTGGAAGGCCCAAATTAAATTGC
AGTGTTAAAAGCATGGACCAGATAATCTTAAAGTTAAAAAAAAAAATGAAGAGCAGGATT
GGGGCTTACCCAGGCCATTCTTTTCTTTTCCCTAGTCTACAGGAGGTCTAAATCTTGTTA
ATTGACACTGGTCCTGAATTCTTATCATACTTGCTCTTGCTCAATGGAAAACAAACTCAG
ACTCCCAGCTAAGCAGAAAACATGTGACATGTGCACATGCACATAATTTTGTTTTTTCCC
TTGAGGCAAAGAGTTGTTAGTCTTTCTCCGGTGTTACTTTTTCTCAATTATTGTGTTAAT
GTATTTTTGTTCTGTTCTATATGTAGATGATGGTGGCTACTCCATGAATTTTACCATGAG
TTCTTCCAGAGGACCTCTGCCAGTAAAACGAGGACCACCACCACGAAGTGGAGGTCCTCC
TCCTAAAAGATCAGCACCTTCTGGACCAGTTCGTAGCAGCAGTGGACTGGGAGGAAGAGG
TAATTGTGGCATTCATTCAAATCTGGGCTGCTATGTTGAAGCCAGGCATGGTGGTGCAAG
TCCAATCCCAGCACTGGGGGTTGGGGTGGGTGTGTGTGTGTTTGTGAAGAGAATCGACAT
GAGTTCAAGACCTACATGGGGCAACCTTTTATTTTTATTTTTTAATATGCTTGGCCACTG
AGAGAGCTCAGTGGGCAAAGCATTTTTACCCACTGATTTGATTAAAAATCACTGTTTTTT
GTAGCCTGTGCTATTCACACACAAAAGTGGAAATAGCATATTGACTACAGAGTTGTCCTC
TGACCCACATTAGCGCTACCACACGCACATGCTCCCACCATAAATGCACAGTAGTATGTT
TTGTTTAAATGCTTATGCTTCAGACTGATTGATGGATTCCGATTAATCTCATTTATAATT
AGTAGACACTGAAATTATGTGACTGGGAAGCTTCCTGTCTTAGCTCCATAGCATATTCGA
TTAAATCCCTTTTTATAGCCTGAGTATAACTAATGTAGCTTGTCCATGGCTAGATTTTAA
TGCTTATTTTTCCTTAAGCCCCTGTGTCCCGTGGAAGAGATGGTTACGGAGGCCCGCCAC
GAAGGGAGCCCCTGCCTTCTCGAAGAGATGTTTATTTGTCCCCGAGAGATGATGGATATT
CCACTAAAGACAGGTAACAGAAAAGTGCATTTCCTTTTATTAAGGATCACGTTGAAAGAA
AGCACACTGGAAGCATACACCAAATTTTCTTTTTTTTTTTTTTTTTGTAGCTATTCAAGC
AGAGAATATCCAAGTTCTCGAGATACACGAGATTATGCACCACCACCAAGAGATTATACT
TACCGTGATTATGGTCATTCCAGTTCACGAGATGACTATCCATCAAGAGGCTATAGGTAA
GTGGCTACTTATGTCTGTGGTTGGCGTATAAGAATTTTCTGTAAAATTTCATGCCTCGGG
GGTTTGGGAGATAACTTAGCTGTTAAAGCACTTTACAAATATTCCTGGTTCTCTGCGTAG
CCATCCTTGAAACCTGTGTAAAGGTGAAAGGGAGAGAAGAGATTCTGGGTGCAAAATAAT
CTTTTGACCTTTATAAGATCACCATGGCATGATCATTTCTCCTCACGTACACTTTATCTT
TACATTGGGCAGCTAAAAAACAAAACAGAAAAAAAAATGTGTTTTTAGATTGGGGTATTT
TAGAATTATATTATAAAATAACATGAGATGCTAAACTGATGTATATTTTAATTTAAAATT
TGCTTTTTATTTAGTGATAGAGATGGCTATGGTCGGGATCGGGACTATTCAGATCATCCA
AGTGGAGGTTCCTACAGAGATTCGTATGAGAGTTATGGTAAGATACCGGTTAAGGATCTT
AAACTATCACCAGCTTGAGGTTTTAGGTTCATGAGCTGGATTAATAGGCTGCGTGGTGCT
TGCTTTTAAAGGGACATTTGCTTGCTTTCAAGGGGTAACTTTATCAGCTGGGCTTTTCCT
AGTTTTGTGAAGGGTGTTTTGGTTCTTTCCTTGTTTTGTTTTTTGTTTGTTTGTTGTTTT
GTTTTGTTTTTACTTTTGAGGCTGTTCGCTTGCTTTGGAGGGGATTTTGCTTGCTTAAAT
TGGCAGCCTTATGTGTTTTCCCCCCCAACAGTGAAAATACAATTTAAAAATTTTATTAAC
CAGATCAAATATTTACCATTGCAATATGAAGGAAACTCAACAGTTCAAAAATTGCAACTT
ATCACTGGAAAGTGGCTGAGTGTCTACTCTAAAATAACAAGCTGTCTGGAATGTCCTCTT
GAAATACACAACGTCTTCAGTCTTTTCAAACAAACATTAAAATCAATCCGTTTCCGTACC
TCAGCAGATGAGCAATTCCCTCTTATGGCCAGCAATGGTAGAGTTTAAAACTTCCCAGTT
GAGAAAGTGAACTTTTAATACAAAGAATTCTGTAAATTCAGATTTAAATGTTGTATATAT
ACAATTTATAGTGTTGCCATATTACCTGACCATTGACCCTGCAGGTAACTCACGTAGTGC
TCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATGATTACAG
CAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAGCCGAAGTGATCT
CTACTCAAGTGGTCGTGATCGCGTGGGCAGACAAGAAAGAGGGCTTCCCCCTTCTATGGA
AAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAGG
TGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATACTAGGAACA
AACAAAACTTTTGGACCAAAAAAATCCCCATTCAAAGCAACAAACAAAAGTGGAAACTTT
CTGTCATAAACTACCCAAGGACTACTAAAAGGAAAAATTGTGTTACCTTTTTAAAATTTC
CTGTTCCCTTTTAATAATTTTTATGTTCTTGTGAGGGAAAAAGTAAGACGTGTTTAATTT
TATTTGCTAGTATGAGCTGCTTTCAACAAGCAAATGGTAGATGTGTGAGCCTTGACTTGT
TCCTAGTGTTGTAATTTTCCAAGTGAAAGTGTCCCTGAAGGCCAGCCACTTCCTGATTTT
TTTCCCCAGTAAATGAGGCAAGCAACCCCAAGATCATCCACAAACTTCCAGCCATCTAGA
TGGCCTCTGGTCTCCACTGAGAGCTGAATCGCCCTGCCTGTGCAGACAAGCTAGCCATTA
GAGAGGGTTGGTTGGGTGTGCTACTTTCAGTATTTCAGGGTGTCTTCCAACTGAAATCTC
AATCTTCGCAGTATATATATTAAAACCAACGAGCAAACCTGAGCTCCGATGCCTAGGATG
TACTGTTTACCCAGAAACCCCCCAAAAAAGCAGATGGATACTGGCCATATTTTGCTTTTT
TGACACTTCCTTGGGAATCTACAAGAACCTCCCTTCCCCCTCCCCGAGTAAGACCTAAGA
CCATTTAAGTGTGTGTTAAACAACTACAAAATACTCAATAAAACGTTTGGCCAAAGTCAA
CCCTGAAGCTGCAAACCGATGCTTGCTCTTACTGTTTCAAATTTTTGCAACTCTGTAGTG
TCTCACTTTTAAAGGAACAGCTTGATTGCAAAGGAGAAAATAGATAAGCAATGAAGTTAT
CTCCAACTTCCTAAAGGCTTATGACTTCTAAAAAGTGAATCTATCAGCATTCCACATCAG
ATTTAAAGCACCAAATGCCCGTGAAACAGCAAAGATGGTAAGCAAAGCAAACTAGTTTTT
CCGTCTAAGTCGAAATTGAGCACTTACCTTCCTCATAGTACAGTGATGCCTACTGTACTT
CCTGGCAGTGGAAATGCCTTCTAGATTTAAAAAAAAAAAAACCTTGGAAAAAAACCCCAC
AAAGGTTCAATAGCCTATTAGAAGTCCTCCAAATTCAACACTTGGAAATTTTTTTAACGC
ATGTATGACACTTAGAGGCATTAATGCAGCCATTTTGTTTATCAATAGCAGTCTGGGAAC
TGGGAGGGGGTGACTTTTTTCTTATATATTTTTGATGAAGAACTGTAAACATGCTTCATG
TTTTGACTTTTTTTTTCAAATTAGTCTTGTAGTCAATAGAAGAAATGGCTTAGGATTGGG
GTCCCCCTGTCTTGACCCCTATAAGCCATTGCAAACTTGACCTTTAGTTGGATGCCTAAC
TTGTTTTAGTTCTATGAAACTACACTGTATGGAGAAAAAAAAATCTATTGCAAGTGGTCT
TTTAAAAAGCAAAAAAACCTGAGGCAGCATGACCCAGGTCCAGCCATGAAGTTGAAAAAG
ATGCTCTTGAATATAGTAAACTTGAAGACCTCCAACTAAAAATCCTTAGACTGCACTTAT
TCCTTCAAATGTTTTGTCGGTTCAACTTATGGATTTAACGTGGCAGTGCACCATTGGAAA
AGAATGAGAATCCATAAGCCATGCAACTTAACCATTTAAGCCATTCCAGTCCATCCCAAG
CCAATGAACCTTCCACCAATTAAGAGGAGTAGTAGAACATGAAATATGCATTAAGCTGCA
AGTCTGAACTTGCCTGTTCTTTCTGGAAAAAGGCGAAGGGGGGAAGCAGTTATAGGCAAG
TGGTCAACTATTTCCTCTAGAGAAATAACTAGATTTCATTTATGCAATTTTTGCAGGTTG
AATCTAATGGTCATACTGTCCTGGAGTGCTGATTGATTGATTCACAGTAGATAAAGCTGG
CAGTAAGGAACAATCAGATGCTCAGGTAAGTGTTGAAAGCAGTGTCCTTTGAAGGTTTAA
ATAATGCAGCTTTGTCATTGTGTGGCTGTGGTGTTGGCAAGTATTTTCTTGACCCCTAAT
TCATTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1185, 2336..2470, 2659..2765, 3802..3973, 4466..4618, 5178..5292, 5390..5515, 5894..8007
2362..2470, 2659..2765, 3802..3973, 4466..4618, 5178..5292, 5390..5515, 5894..6014
AJ237847.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved