Mus_musculus Locus Rpl39
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl39
Mus_musculus
Rpl39
X
SNORA69
3142..3272
4625
GGCAGGATTGCGTAACTGGTGCTTTTATCTACTAACGATTCCCCTGGCCCTGGTATATG
GGATTTTTACCCCACCGGAGACAGAGTTTCTCTGTGTATCTTTGGCTGTCCTGGAACTCG
TGTGAGTAAACCAGGATGGTCTCAAACTCAGAGGTCTGTCTGCCTCCCAAGTGCTGGGAT
TAAAGGCGTGCACCACCACTTTCCGGCGCCTTTTTTTTTTCTTAAGATTTACATATTTAT
TTTATTTATATGAGCACACTGTAGTTATTCACTACAGATGGTTGTGAACCACCATGTGGT
TGCTGGGAACTGAACTCAGGACCTCGGGAAGAGCAGATGGTGCTCGTAACCGCTGAGCCA
TCTCTCTAGCTCCGCCTCCCTTTTAATCAAGTATTTTTAGGTACTATTGATAATGGGTCC
GTGTGTGTTTACATGGGGACGTGTACCTGTAAATCATAAGTGTAGGTGCCCCTGGAAGTC
AGAGACATGTTACCCCCTAGAGCTGGAGGGTTGTAAGCTGCCTGATATGGGTGCTGTGAA
TGGAACTTGGATTCTCTATAATAGTGAAGTTAGTCATTAAAAGATGTCTGCAGCCCCATC
TTCCTCCCTTCCAGGGTGCATCGCCAACCCTAAGCCCCGCCCCTCTCGCAGAAGCGGGGG
GAGTTGCAGCTCTGGAAGTGATGTAGGCCTTTTCCCGCCCTCCTCAGAGTTGGTCCCGCC
TACTCCGTTTCCAGGTGTTTGCTAAGGGTTTACTTGGTTACTTCTCAAAGGCCACCTACC
ATGGCCACCAAGGCTGTGGCCCTCAGCACAATGATGATCACCTGCAGGAACAGGCATGGA
CGCGGAGGCCTCGGAATTACGTTCTCTATAAACCGGTTTGGGTTCCCACGGCCCCATGGG
AGCGCAGGGGTGGAGCTAGGGAGGACGCTGCGAGTCATCCATCCCCCCCTAAGCTCCGCC
TCTAGCGACTTCTTCTAATCGCGTTCTTCCGGTCCCGGCCTTTCTCTTCTCCATTCCTCC
GCCATCGTGCGCGCTATTCTTGATTCGGCTTCTCGCCATGGTAAGACTATCGGCCGCCAT
CCGTCCCTCAGCGGCTTTCCTGAGGCCACAGACCGCTGTGCCTTTGTGGCAGACATGCGC
AGCATTGAGGGCTGGGTGTATTTTTCAGGGTTTTAGTGTTCGTTTTTGGAGCTGGGACAC
CTATCGGCCTGTGGGCGCGGCATGAAATTATCAAGTCCATTTACCCTTGCAGGATGAGAA
CGCTCTTCCTGCAGCCTGGCAAGGGGTGCAAAGTATTCTTGTTTCATATAGCCTGGGGCT
GACGGTGATCTTCATGATGGGGGGGGGGCAGAACGAGAGGCTTGGGACCACTCTTAGATT
GTCCCTGATCGAAGAGCATGAATCGCCATTTGCACAGCGAGATGTCCACAGTAAGGGTTA
ACAGAACTTTGAGATCCCTTCAGAAGTTAGCGCGTCACTCCTTGGAGGCGTCTGCTAACA
GCGCATCAGTCATTGCCTACTGGCAAGATTATGCTTATGGGCGTCTAGGTACAAAGTGGG
TTTAGTATCTGAATTTGTTAAATAAAACCTCCAACTGGTCTAGGGGGACGAGTGCGCTTG
GCCTTCGTTGCATTTTTTTATGTAATGGTGTTTGCCTACGGAGTGTCTAGGGCTCCGTAA
TCTTAGGTTAGCCAGCAATGTCACTTGGAGGTAGATAAGACTTACAGAGTACAGTACCTA
GTGTCATTGACTTAAAACTGGCCAGGGTTTGCCTAACCTCAAGCCATCCTTGTTCCAGTA
AGTCCGTTTCCTCTCCTACTCCAGCTATTCCGTGTTTCATCGCTGGAGCCCAGCAGACAG
CCAGTTTATAGGTCAGACAGGACCTGGGCTTAGAAACTTGGTGCTGATTATGAGCCATGT
TTAAGCCATTAACTCTTCCTCCAGAGAAGTGATGAGGATAAAGGACTTGGTGGTTCGAGG
TCGGGGAGCTTTTCCTGGGTGTATGTTCTGCAGGCCTGATGTTAGTTTGTTGGAATTTGT
GACTGAATCAAGAGACTAGGCTGTGGTGTCACTAAGCTGGTTGCATCTCCTCGTAGTCTT
CTCACAAGACTTTCCGAATCAAGCGATTCCTGGCCAAGAAACAAAAGCAAAATCGCCCTA
TTCCTCAGTGGATCCGGATGAAAACTGGTAACAAAATCAGGTAAGCCTTCTCTTGTCCGG
CTTGGAAATCGTTATGTTTTAAGTAACTTTGGGCATGGAGATACACAGTTGCAAAGTACG
GTCCACCCCAGTCAATTAGTGTGCTGGGGACTCCCTTTTGAAATGTTTTTCCTTTTGTTT
GGGTTGGGAGCACGGGGTTGAGAACTGGGAGGAAACACTTCTCCATTCATCAAATGGGTC
TTGGGGCTCTAGCTCAGGTCATGAGGCTCCTTGGTAGTGACTAGCTTACTTAGCCCCCGA
AATCCCTCCACAAACCTTTTATAAATGCTTCCTAATTTCCCTAGGAAGGCTTCAAGGGAT
TTGACTATTCTGGCAGGAGTGTTCTTTCCTGCAACCAGAGTTGAGCTCAGGACCAGCTGG
GTCTTTGAGAGAGGTGGAAGGGATCGAACCCAGGGTCTCCCCCAGGCAAGGGAAGCGCCT
TTCTGAGTTCTTTCTGTGGTGTGGGGGATGCAGGCCCACATGTGGTCAGAGGACAGTTGG
TGGGAATTGGTTTTTCCCAACATGCTGGGATTAAAGATAAGCATTGCCCAGTTTTGGGAT
TAGTAAAAATCTGGGTGTGGCTCTGCTGGGGCAAAAAGTGAGCCTCCTTGTTCTTAATTT
AGCCACTTAAGCTTGATATCAACAACCCACTCTAGCCTTACATTCGAGTTAATTACTATC
TTCTGTCTTCTGGTATGGTACATGTATTTAGAGACTTTACTTGCAGTCAGGACTAGACTT
TCAAACTTTGGTTCCCCCCCACCCCCATAGAGTGCTAAGGAAAGCTTTGAAGCACTAGGC
AGCGGACCTTAGATGCTTTACCGGGTAGTCTTTTGCTTTTTGAAACAGTCTTGTTTAGCC
CAGGCTGGCTAATCTGCTCCAACCTTCCAAGTAAGTGCTGAGGTTACAGGTGTGTGCCAC
CTTTATAGGTAACTTTGAAAGAAAAGCAGGTAGCAATTACAGTGCTTCATTTTGTGGGAG
TACTGCCATTATCCTGCTGAAAGAAAAGCCATGTTGGTTGTTTCTGATTTTTGCTTTTGG
GGTAAAAATCGTGACACCTTGACATGAACAGTTCAGAGACTGGTTAGCTTAGCTCTGCTA
CTTACTGTAAGTCCTTTTATGCTCTAGCAAGCGCTTTAAATAAATTCTCTTGTTCCTCTG
AAAGTCTGACTCTGCTAGAGGAGCAGGTTTGTTGTGACCAACCCACCTTGTAACTGGTGG
CTTCTCTTTGTACAGGTACAACTCTAAGAGAAGACACTGGAGGAGAACGAAGCTGGGTCT
GTAAGGATTCACACAATGGCAAGACTGAGGATTTATACTGAATTGTCATCAATCAGTCCT
ACCAGATGGATTTCAACATTTAAACCTGGAGACTCTTCGTGTCTTGAATTAGGATGTTTG
TCCAGTAATAAAATATAGAACCTTTCAAAATGCTTTTCTGGTTTATAAAGTACTGAATTG
CCCTTATAAGACCCGATAAGGCTTCTTCTGTGGGGTAAAATATTGTTTCCTAGGAGCTAG
AGATTACTCAGCAGATAAGGGTACTTGGTATTCTTGCAGAAGTCCTGGTTTTTGGATCCT
AATACTCATAGTTTTTGTTTTAAACCTTAAGATTGAGTCCACATGTTTAAGCCACAGTGT
TAGTGTAGAGGTCAGGACAACTGGAGTCCTCTGTTTTTACATGTGTTCCAGGTGTTTATG
GCAAGGGCTTTACCAACAGCTATCTCAGTGAAAGCAATCCCCCACTTTTGCATAGTGGCT
TTTTGTTTTTGTTTTTTTTTTTCCAAGACGGGGTTTCTCTGTAACCCTGGCTGTCCTGGA
ACTCACTCTGTAGACCATGCTGGCTTCAAACTCTGCCTGCCTCTGCCTCCCAAGTGCTGG
GATTAAAGGTGTGCACCACCACCGCCCAACAAAGTGGCTTGTTCTAATCCCTTGTGTTAT
AGATTGAGCTCAGGGCCTCATGTAGGCCAGCACTCACAGCAACTGGACTGCACCCCTAGC
CCTGTAGCAGTGGTTCACAACCTAGGGGCTGATCCTGTTTCACAGGGGTTACCTAAGGCC
ATTGGAAAACTTTACAAATCACAACAGCAAAATTATGAAGCAGTGAAAAATTTCATGGGG
GGGGGGTCACCACAACTTAAACTGTATTAGGGTCATAGCATTAGGAGGGTTGTGAACCAC
TGTTCTATAGGCTCTTTAATATGAATGTGGACCTTGTGGGTACAGGAATTGAAACCAGGG
TCTCTGCAAGAATAGTACTCTACTGCTTAGCCATCTCTTCCAGACCCACATAGCCTGAGA
GAAGCTGCTTTAAGGCTGGGTAGTTGGAATCATAGGAACTAGGGGTTGGCAGTCTAGTCC
ACAGCCGCCTCCTGTAGAGATTTTTCAAGAGTATTCTGATAATATTACGATTCAAGCTTG
TCTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 2096..2199, 3435..3625
1057..1059, 2096..2199, 3435..3480
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved