Mus_musculus Locus Tpt1
snOPY snoRNA Orthological Gene Database
Mus_musculus Tpt1
Mus_musculus
Tpt1
14
SNORA31
3813..3942
5214
GATCTATGTAAATGAGCATTTTTGAATAATTTGAAAATGAATACCTGGGATGTGCAAAT
AAGATTCACATAACTCAGAAATAACTGAGTTTTGAGACTGCTAAGTCATAGCCCCTCGGT
TCTATGTCTACGTTTTCTGATGTCCTTCACTTTTTTACTGTTACCCCGTGTCCTTTAGAG
TATCTAGGAAAGCAGCAGACCACCGCATCTTAAGTGGACGGTTTTTCTTCTGCTCTTTGG
CTAGAGTTTTATTCCTGAATGGTTTACTCTGTGCTTGTAACACTTTGTTAGTGTGAACTG
CCTTCTCCTTTGACATACTAACCTAACCTTCTGTCCGAGGGCAGGCAGGGCTGGCTATGT
CCTTCTTAAGCGAGAAAATTGCAACACTAGGGTTACAACGGACTATAACCAAATCTGGAA
GGGAAGAAACTGTGATTTCATCCTGCCATACATGTTTACCTGAACGGTGGGTCTCGGAAG
TTGTATGTTGTACTTCGTGGTGGATGCGAAAGCCCTTCAAGTGACCCGGGCAAGTGGGAA
GCTCCTTATTTTGGGTCTGTTTAGTCCTGCATCGCCAGGAATAAAAGGGATAAAAGTGAC
AATACAGAACTGTCCTAACAAAGGACACCGTTTGCGACCAAGAGCAGAACAGGCCAGCGA
AGAGCTGTCCGGCCAGACCCACCGCAGGCTTTCACTTTCGGAACCCACTAGAGGACCAGT
CCCCAGGACATCTCCCTCCGCGAGCAAAACCGGTGCAGTCTGTGGGCAGCCAAGGACCGG
AGGTCGGAGACCCGGGACACCAGCCCGGCGCCATCCCCGTAGTCCCCGCAGGCTCAGCGG
CGCGCCCGACAACAGTCATCCGATTCTGCTGACATTTTCTTTCCGAGAAAGGGGTGGGAA
CTGAAGCGGCGTGGCGGGAGGCGGGGCGCAGTCACACCCTGGCCACGCCCGGGCGGCGAC
TCAAGCGTCCGGCCATCGGTCGGCCGCAAGTCCCTTCCCGTCCCAGCATGCCCCGGGCGC
ACTATCCGCACACCGCCCCCGTTGCCCCGCGCACCCAGGGGCACTCCGCATTGTGTCCCA
GCAGAGTCCCCGGATGCCCTCCCGGGGCCGGCCGGGCGTAGCCACGCCCCCGCACCGCCC
TGCGTTCACGTCACCGCTGACGACAGTTCCGGGGGAGCCGCGGACGGTGACGTAGCCGAG
CGTGCCCTCTATATGAGGTTGGGGAGCGCCCGCGTCGGCCTTTTCCGCCCGCTCCCCCCT
CCCCCCGCGCGCCGCTCCGGCTGCACCGCGCTCGCTTCCGCGCTGTCAGGCTAGCGCCGC
CGTCCCCAGCCGTCACCATGATCATCTACCGGGACCTCATCAGCCGTAAGTCCCGGCGCC
CGCGGGCCTGGGTGCGGGTGGGCACCGGGGAGGCCGGGGACACGAGCGCAGAGCTTGGGC
CGGGAGCCGCCGCGTGCGCCGAGCCCGGCGCGGGAAATGGCGGGCCTTCGCTCGCTCACG
GGCGGCTCTCTCTGTTCGCTTTCAGATGACGAGCTGTTCTCCGACATCTACAAGATCCGG
GAGATCGCGGACGGGCTGTGCCTGGAGGTGGAGGGCAAGGTGAGCGGGGCGCCGCGCGCG
GGGAGGCTGGCCGCCTGCCTGCCGGGTCGGCCGAGCCGGGCCGGGCTGGGCTGGGCGCCG
CGGGGAGGCCGCTGGAACTCGTGCAATCCTCGCTGCCGCCTCCAGGCGGAGGAGACGCTC
TTGCGGACCTTGGGTTTTTCTAGAAAAGTGGAGGCGGAGCCGAGCCTGGAAATAGGTCCG
CGAACTCAGCGCCATCCTCTTTCCGGGCGAACGGGGACATATTGTCTATAAGACAGGTTT
GCGCTGTGCGCGCTTAACCCGTGGCGACTCGAGAGAGGCCACAGCAACTTGGTTCCGCTT
GATGAGAGTGACCACCTCTCTCAGTCCGGGCAGCGACTATTTGGGGGGAGGTTAAGATGT
TTCAGGGAGCTGACTGATCGTTGCCGGACCTTTTTTTTTTTTTCTCTTTTTTTCTTTTTT
TTTTTTTTTTTTTGCCCCTTCGACTAAGTTGTATTGTCTTTTTGTTTTGTTTTGTTTTCT
TCTAAATGTAGATGGTCAGTAGAACAGAGGGTGCCATCGATGACTCGCTCATCGGTGGAA
ATGCTTCCGCTGAAGGTCCGGAGGGCGAAGGTACCGAAAGCACAGTAGTCACCGGTGTTG
ACATTGTCATGAACCATCACTTACAAGAAACCAGCTTCACAAAAGAGGCTTACAAAAAGT
ACATCAAAGACTACATGAAATCGTAAGTGACATAAACACCCCGTTTTGGTGGTCAGCTTC
CTAGAAGAAGTTGGTTGCTTAGGTAGGAAGGGCTTAAGAAAGGAGGGTCTTTTGTTATAC
AGTGAAGGTTGATTTTCAATAATGTGAGCAAGCCGGTAGAAAGTTACTTTAAAGGTAATA
TAGGAATTACATTCTTTTAAATGGTTTCTTGTCACCTAGTAAACTATCATTTTGCTAGAA
GACATTACCTATTGGAGCTTATATTCTTACTTTACTGAAAGATTATTCAGTATTTTGATG
ACCTGTTACTTTACTGTTTTAGACTCAAAGGCAAACTTGAAGAGCAGAAACCAGAAAGAG
TAAAGCCTTTTATGACTGGAGCTGCAGAGCAGATTAAGCACATCCTTGCTAATTTCAATA
ACTACCAGGTAAATGGACCAAAGGGTTGTATAATAACTGTGGGATCCGAAAAAGTCTGTT
TGCTGTCTCGTACATGGCTCTGGCTGTCCTGGAACACCCTTAGACCCAGTTACCTCAGCC
TTCTGAGATGAAAGTCTCAGCCCATTTTGTGTAGCACCACACCAGGCAAGGAGCTGGTAT
TAAAATGATAGGCATTGCTTTCTTTTCATTGAGACTGTTATCTGTAGACCAGACTAGCCT
TGAACCCAGAGGTCTACCTGCCAGTGCCTCTTAATTGCTGGGATTAAAGGTGTGTGCCAA
CATGGCTAGCATATGTGTTATTTTTGAGAACTAGGGGTTTTTCTTGCCAAATTTTGGCCA
GGGGTTATTCTGGATCTGCTTTTTATAGTTTGATTTTATATTTGTGTGTATAAGATAGTC
TAATTGTAGGTTTTTGTTACGTGTTTCTTAAGTTTTTTATTGGTGAAAACATGAATCCAG
ATGGTATGGTTGCTCTCCTGGACTACCGTGAAGATGGTGTGACTCCATTCATGATTTTCT
TTAAGGATGGCTTAGAGATGGAGAAATGTGTAAGTATCTTTAAATTAGTAGTGTCAAGAC
AGGGAGTGCAGCAGTGATTCTTTGCCATCTGCAGGTGGCAGGCCTTGTAGATTGTGAGAT
CTTTATCCTGTGGGAGAGTAGAGCCTTGAACATGAAAGGGGCTTGAAGATGAGATTAGCT
GGCTTGCTAGAGTGCTCAGGGTCATGTGTGTAAGTAGTTTGACACTGGCCTGGGATAAAC
TCACGTAGAATGAGTGTGGTCTCTGCCCCACGGTAGTTCAAGTCCATTTCATATTACATG
CAATAGGATGTTTCAGTGTTTACTGAGGTCAGTAAGAAGGAATACAGAAATGTCTGTTTT
ATAAGGGACTGGTGGAGACAGTGTTCCTTGTCCTAGATTTTGGAGGCTTTTTTTGTAAGC
ACAGTAGAAGGTGAGTTTAGAGATGTACTGGAGAAAGTGGGTGACCGCCTGGGACAGTGG
GGTAGGAGTGTTATTCAGACAACAGCTGGTGTTTGTCAGTAGAGCACTGGAGTGGGCAGG
AAGATGGGTGAGTGCTGCCAACTCGGTGAGGGTCTGCATCCACTGATAGACCTCGAACAG
TTTGTGGTTGTTCTTCTGGTTTGCACTAGGATGCAAAAGGAAACTCTCCCTGCGCTTCCT
GCCTGCCTTTGTGGCAGTTCAGATTGAATTAGGGAGTACATCTACATGCTAGGACAGTTA
TAAGCTCAGGCTGGGGCAGTTGTTAATGCCATCTCTTTGTTTTGCAGTAACAAATTGGAT
CTATCACCTGTCACCATAATTGGCTGCTGCTTACCATCCATACAACACCAGGACTTAGGA
CAAATGGGACTGATGTCATCTTGAGCTTTTATTTTGACCGTGATTTATTTGGAGTGGTGG
CATTGTTTTTTTAAGGAAAAAAAACATGTCATGTGGGTTGTCTAAAAATAAAGTGCATTT
AAATCCACTTAAGAACTCTTTGCTGTGATTGTGCTGACCCTGTAGTCTGAGAAGCTAGAG
CCTGGTTGAGCATCGCTAGAAAGCTAAGCCTCTTCAGTTAACTGCTGCAGTGGGGACTCT
ACAAGACTGGAGTGTGTGAACTCAAGAATCTCAGTTACAGTGAAGGGAGAGGTGAGAAGT
GGACCCTGACTTTCATCACCTCCAGTGGAAGAGCTTACCAAAAGCACAAAAAGACCAACT
AGTTGGAGACAAGTACTGTCTGCTCCTGGACTAATGTCAGATTCCTGGTAACTAGAATAG
AGGTTGCCAAGCCTGGCCTGTGCCACTTTAGAGTTGTACAAACAGGGCACAGATCCATCG
GGGAGTTCGGTACCTGGTGGGGTGGGATACAGTGAATACAGCGTAGTTCCTTCCCGGGAG
TGCCAGCAGCCCATGCTTACTGGGGTAAGGTTAGATGACCCAGTCACCTGCGGGAATTGG
GTCTTGGAAAGCCTAGAACTGCATAGTCTGCTGTAGGAGTATTAACATGCTTTGCTGTCT
AAGGTTTGTCCAGTGATAGAAGCCTTAAAAAGGTACTAAACTTAAGAGGGTACTAGCACC
TCTGCAATATGAAGCCCAAATAACTGGATACTAGGTATTGTGATGAAGGGGAAGTGTTGC
TAGGTCTAGGAAGCCACTTAGCTGTCTTTGAATTTTAATGGGTCTTGAGGTCACTGGTCA
GAAAGAAACTTGAGAAAAGTTCTAGTGCTAGCCCTAGAGAAGTGAACACAAGACAGCAGA
AGCTTGGTAGGGGAGGAAGACCAGAACTCAATAGTATACACATTTCAGATTATGAGTAAG
CATATATGTGTTTGTGCACGTGGCTGCAGATGCCCATTGTCAAAGGAGAGATTTCCTGGA
GATGGACATAAGTATAGGGTACCAAAGGGCCCTGCTGAGCCTTCCTTGACTGGTTTGGGT
TGTTTGTTGAGAGTTTCTCTGTATTCCTGTCTTGGAACTTGTTTTGTAATCTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1364, 1525..1598, 2111..2301, 2602..2707, 3152..3268, 4007..4214
1337..1364, 1525..1598, 2111..2301, 2602..2707, 3152..3268
XM_001479983.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved