Mus_musculus Locus Gnl3
snOPY snoRNA Orthological Gene Database
Mus_musculus Gnl3
Mus_musculus
Gnl3
14
SNORD19, SNORD19, SNORD69
3734..3809, 4797..4868, 5649..5728
8581
GTGTATTTGTCATTTGTTTTCCAGGAATTTTATATTTTTGTCCCCCCTTTGATATCAAA
TTTTCTTAAAATAAGACTCACTTCTTCAGAAAACAAAATTTTGAAACGGAAAATACTTTT
AAAACCAGAAAATACAGTTTACAAAAACTCAACTCGTCGTGACGGTACAAATGAGAAGCT
TAAGTACCTAGCCTGTAAATAAGTAAGTCTCTCTGACAAAAACAAAAAAATATTCCGTTT
GGGCGATCATTGGGAAAGAAAAAAACAAAAACAAAAACTCAATAGGGAGTTTTTTGCCGA
ACGCACAAGAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGGC
CTTGAGAGGCGGAGGAAAAGAAGAGTTCGCCCGACCTGTCACTGGTTCTGGGGCTAAAGG
AAACGTTGACAGCTTTGAAGGCGGCCCGCGACGGGCGGGAAAGAGCAGCGAAGGGAGTTT
CCGGGCCCTGCTCTGCCTTTGTCCCGGCGGCAGGTGCGGCCGGGCTGCTGGGCCCTGTCC
CGAGGCCCCGCCGCCGTGCCGTGCCGCGCCCCGCCCCGCGCCCTGCCCGACCAGCGCGTC
CGCACCACGGGGCGGGGCCTCCGCCGCGACTCCCGCCCGCCCGCCCGCCCGCCCGGGCCG
ACACAAAGGCCCGGCAGCCGGCCGAGGAGGGGCGGCCCCGCCCGCCCCGGGCCCGGCCTT
ACCCCGCCGCTCCGCCGCCTGCAGCCCCGGCTGCGGTCCCCGACCGCCGAGCCCCGCCCC
GTGGCCGCCACGGCTGCTAGCGCTCCTCTGGCCGCGGCCGTCTCTCCGGCACCCGCCGCC
CTCACCGCCCTCACCCCTCCCAGTGCTGCCGTAAATCCAACCTGTGGCCGCCAGGCGAGC
CCGGCTCGGCGCGACAGTGTATGTGTGTGCGCGCGCACTCGGCCCGGCCCCGACACACTT
TCCGGCAGGTCCTGGAGCGCGTGACGTTGAACCGCAGTTCCAGTTCGCACGTGGCGCCCG
AGAAGTCGTGGTGATCCCGAGACCTCCTCTGCTCCTGAAGCGTCCGCGGCCAGGATGAAG
AGGCCTAGTGAGTGGGGTCGGGAGCGAAACGCGCGGGTGGTGCTTTGTGGCTGGAGGGAG
AGGACTCTCCATAGGCCATTGATGAGTTCCGCGTAGATCTGATGCTTAGAAGGCCCAGAC
CCAAATTTGGCCTGTTGTATAGCAGGAGAGCTAAGCCCTTGAGAGGAAAACCGAGCCAGA
TTTCTGTGATTAACGTGTTTGAGCCTCTTTTCGAGCCTGCCGTTTTCCTAGAACTATTCA
GAACCATGGTCTTTCGGCCTTGGTGGCACGCGCCCTAATCATGTACACGAAGGATGACGC
AGTAAGATAGAAAGTTTGCAGCCAGCCTGGGCTGTATACTGAAACCATGGCTTAAAAATT
AAAAAAAGAGCCTGGCCGTGTTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGG
CAGGCGAATTTCTGAGATCGAGGCCAGCCTGGTCTACCAGGACAGCCAGGGCTACACAGA
GAAACCCTGTCTCGAAAAAATAAAAATAAAGAAAGAAACCTTGATATTTGTAGTGCTTTC
CTCTAGAAGCTGCTTCCATTGTGGGTCCACCGAGTCGAATTGACTGGCGTTGTGGTGTGA
TTTCCATTAAATACCCTGCATAACTTTGCAGGGACGGTTGAGGCAAGATCTATGTTGCCC
GGGATAGCCTTATTGTTGTAGGCCCCCATGGCCTGATAAAACAATCTCTTGAGGGCCAGG
AATATGGCTATAAACACTTGCCACTAAGCCTTACTGTCAAGAGTTCAAACTCATATGATA
GGTAGAACTGACTCCTGGAAATTGCTTTCAGACCTACACACAAAATAAGTAAATGAAACA
TTTTGGGTATGGAGTGAAGACCCAGGGTTGTCCCAGCCCACGTGGCAGCTCCATGCTGTC
TGTAGAAGGACAAGTGATGAAGCCCTCTTGTGGCTTCCTTTGCAAGAACACTACATGCAC
GTGGTTGGTCTGCTGACAAGAGAGGGCAAAACATCCATATAGGTGATGTGAGAAATTTAA
AACACTCACTGCTCATGTGTGCAGTCTTTCTCTTTCTTTGTTTTGGCAGAGTTAAAGAAA
GCGAGTAAACGTATGACCTGCCATAAGCGATATAAAATTCAAAAAAAGGTAAGTGTTCTG
TGAGGCCCATAGCAAGTGGGGTGCTAACATGGCTTTCTTCATCTCTGTGGGGAAGGCTCT
TGTCATGGTATAGGATTGGACAGACTGCAGCTGTGGGAAAGTACAGGGTAAACGAAAGCC
TCAAGCTAGCACACTGGCATCTTTACAGAGAGCTGCAACACTTTTCTGTTTTTTGTGTAC
ATGTTAATTCCCTGTATAGTTCCAGTTGAAGTTCTGCTTTTCTAGGGTGCTTCACATCCA
TTATAAATTGCGGATAGGCTGGCTTGTTCCCTAAGTTCTCAGTGCTTATGTATTTTTGTA
GGGCGAGTTGTTTCTTTTGTATTAATACTGAGGATTGAACCAAGGCAAGTGCCTTCCGAC
CTCATAGAGCTGTTTTTAATAGGTCCGAGAACATCATCGAAAATTAAGGAAGGAAGCTAA
AAAACGGGGTCACAAGAAGCCTAGGAAGGACCCAGGTGTTCCAAATAGTGCTCCCTTTAA
AGAGGCTCTTCTTCGTGAAGCTGAACTAAGGAAACAGCAGGTAATTTTTGCTGGCTGAAA
GCTCCAGTAGAATGATATATGTGGTTTCCAAAGCAATACACTGCCACCAGTCACTCGCTC
ATTCCTCTCTTTCACGTCTCTGACACAGCTTGAAGAACTAAAACAGCAGCAGAAACTTGA
TAGGCAAAAAGAGCAAGAAAGGAAAAGAAAACTTGAAGTTAGCCCTGGTGATGAGCAGTC
TAATGTGGAAACTAGGGAGGTAAGGTTATCTTTCCTTAAAACTTGCGTTCCTTGGGAGTA
ACAAAACGTAGGCTTTCTCATCCATTTAAAATATATTGCCTGTAGTGATCTGTGGGAAAT
GTTGATATACTGGTAACAACTGCTGTTTCTAATTTTTCTTCCTTTTAGGAATCTGACGAG
CCCAAAAGAAAGAAAGCCAAAGCAGGCAAACAGAATCCAAAGAAGTTACATTGCCAGGAA
CTTAAAAAGGTACCTTAGTATAGGTTAGTGTCAAAAATGATCTAAGATTTTTGAAAACTT
AGTCCTTGACAGCTGCTTTGTAAAGAGGGAATTCTTAGAACGCTGTTGAAGTCAGAGTCT
AAAGGGTGGGCAGTGGATTCCCAATGTGCTTGCTTGCTAGAGCTCCCCATTTCAGGCATG
CATTTCCCAAGCTCACCTACCTGCCTTCTAAAAAGGCCTGTTAACCTAAGGACTCAATTG
GGTAGATTATATGTCCAGACTTAACAGTCAACATACTTGATAGTGAAATGCATACAGGAG
ATCCTATCTTCTGGATTCACTGTCAGTGTTGAGGGTGCTACTCAGTAAGGACTGCTGCTC
TGATGGTTTCTTACTTGACAGGTGATTGAAGCCTCAGACATTGTGTTAGAAGTTTTGGAT
GCCAGAGATCCTCTTGGTTGCAGGTGTCCTCAGATAGAAGAAGCTGTTATCCAGAGTGGG
AGTAAGAAGCTGATACTTGTATTAAATAAGTCTGGTGAGTACAAACACTCCCCTTTATCT
ATTTTGTGCACTATGAGGTATGAGGAAAATATCGGACAGTCTGATTACCACTGAAGACTG
ATAAGATCCAACTCTGACCTCAACAAAGCCAATGAATGTGCACTCTGGTGGCCAAAGACC
TGGGGGGAGGTAGTTTCTGCAAGTGATTATTCACTTGGCTTTTTCTGTTCTGCTTTTTAA
TATTTAGCTTCAATGTGAGTTTCCATAACCACTTTATTTCATATAGGAACTGATGTGAGC
GTTTGCCATTTAAACTGGGGTACAAGAAAAGTTACTATGTGGGATAAAATATTAAATAAA
ATTATTAGATATCTGGGTGGGTTTAAGCACCAGGAAGAGAGCCCAGAAGAAAGAAAAATT
TGGGCAACTAGCTAAATTGCCAGCCTCAATAAATATGTTCAAGCCTCAATAAATATAAGG
GACAAGGGAAAGATACTGGAGAGAAGAATGTAAGAATGTGCCTTGGGCTTAGAAAACTGG
TGCCACAGTAACAAGTAATTCTGGGAACAGGCGTGACTTGACTTCGTGCCTAGGCTGAGT
GAGCAATCCTGGAGATGCTGAGGTTCACACGTGGCTCAGTTGGTCCAGTGCCTGCCTGGT
ACTCAGGAAAGGTGGTTTGTTCCTCATCACCACATAAAACCAAGCGTGCTAGTACCCCTC
TGTGATCCCATCGCTGAGGGGCGAGGGGAGGTTCCAGAGCTGAAGGGCATCCTCAGTTCC
GGCCTGGACGCCATGGGACTGTGGGGACTGAGAGGTGGAGATGGGACACCTCAAGACACA
GGCCGCGCGGTAGGAAGTTTATTTTCTTTCTCTTAAATTTCTCTCAAAACATTGGGGAAG
TACAGATTAGTAAGATCAGTAGTTAACACTAGTCTTAAAACCACTGAATTGAAGTGTCTT
TCCCAATTCAGATCTAGTACCAAAGGAGAATTTGGAGAACTGGCTAAATTATTTGAATAA
AGAATTGCCAACCGTGGTGTTCAAAGCCTCAACAAACTTAAAGAACAGAAAGACATTCAA
GGTATGCTGTTGTTAGTGGTGGGGGGAAATACTGGTTTCTTCAGATCTGTGATGATTGAA
ATGTGATGAGTACACAAATGTTGATGAAAGTGAAAAACATGAAGATCCAACTCTGATTTC
ATTAAAAATTGCAAAGGTAGTGGAGGCCAGCAGTTTTTCTGAAAGCTGGACTCTCTCTGC
TGTCATACTTTTTGTATTCCACCTGGTGATGTTTACCAGAATTAAAATTGCTATATTTTA
TGTTTAAAGATAAAAAAGAAGAAAGTTGTTCCATTCCAAAGCAAAATCTGCTGTGGCAAG
GAAGCCCTTTGGAAGCTTCTTGGAGATTTTCAGCAGTCCTGTGGAAAGGATATTCAAGTT
GGAGTGATTGGTGCGTTTCATTCAGCTTCTTTACCACATAAGTACTTAGTCAGGGTCTTG
ACATTGTGAGTGTGAATAGCTTTGTTAAAACTGACAGGGTTTCTCAAATGTTAACTCTGG
CTCGCCTTGCCAAAACATGGCCTTCTGAGAGTTCAGTGGAAACACTTGCCTGGTGTGGGC
AAGGCAACTATTAGAAAATGTGTTTCTGAGCATAATCCGAGTTTATGTTTATTTGTAGGT
TTCCCAAATGTGGGGAAAAGCAGTGTCATTAATAGCTTAAAACAAGAATGGATTTGCAAT
GTTGGGATTTCCATGGGACTTACAAGGTAAATGGAACTGTCAGTGATCAGAAAGAAATCA
GTAGCTGGTGCTGGGCTAAGAGCATTCCTTGGAAAGGCCCAGAAAGGCTGAGGAAAGCTC
CCTCAGACAAATAGTGTTGGACCTAGTCTTGGAAAAATAAGTTAATAACCTTACTGTGCC
ATATATGCAAACATGAATATGTTTGGATATGTAGTGCACAGTATCTTACAGTGTGTAAGG
TTTCACATAAACATGAAGCAGTGATGACAGATTGGATCTGACTTAACTGCTGTGCTGAGT
TTGTTCAATCCAACCCTGAGCTTCATGTTGTCTTGTCCTCAGATGGACAGTGTCATTGTT
AATTCCATGGCTTTTTTTTTTTTTTAAGGAGCATGCAGATTGTCCCTTTAGACAAGCAGA
TCACAATCATAGACAGTCCATGCCTAATTATCTCACCTTGTAACTCCCCCACTGCACTTG
CCCTTCGGAGTCCAGCAAGCATTGAGGAACTAAGACCGCTGGAGGCTGCCAGTGCCATTC
TGTCTCAGGCTGATAATGAACAGGTAAAAGAACTGCTCTTTATCTGTATAGATTAGGGAC
AGGTCATCTTTTATTTTATTTATTTTTTTAAAGATTTATTTATTAATATAAGTACACTGT
AGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTTGTTACAGATGGTTGTGAGCCA
CCATATGGTTGCTGGGATTTGAACTCTGGACCTTCACAAGAGCAGTCAGGTGCTCTTACC
CACTGAGCCATCTCACCAGCCCCCATCTTTTATTTTTAAGGTGGTGTTAAAATATACTGT
CCCTGAGTATAAGGATTCTCTGCATTTTTTTACTAAACTTGCTCAAAGAAGAGGTCTGCA
CCAAAAAGGTGGAAGCCCAAATGTGGAAAGTGCTGCTAAGCTGGTGTGGTCTGAGTGGAC
AGGGTAAGGTGTCTTTTTATGGGCATTTTGGAAGACAACTTAGAATGAAGAGATTGGCCT
GTGTTTGACACATCTTGTCTTTAATGTTAGTGCCTCATTAGGTTACTATTGCCATCCCCC
TGCATCCTGGAATCATTCTCTGCATTTTAATGAGAATATTGCAGCAGTCATGAAGAAGGG
CTTTAATCTAGAAGAACTAGAAAAGAATAATGCACACAGCATACAAGGTGAAATTCTGTT
TTTTTCTGTTACACAAATGGATATAACATAATAGTGAATGACGACAGAATGCTAGAGGTC
TTATCTGTTAACCTGAGTTTATTTCCTCTAGTCCTCAAGGGCCCTCATTTAACTAATAGA
ATCCTTTTTCGGTCTTCGGGCCTGACAAATGGAATACTAGACGAGAAGGACATAGTCGAA
GAATCACCAAGACAGACAGAAGACAAACAGGATGCTGACGATCAAGAAAATGGTAGTGGT
GAAAGAAATGTAAGTTTTGTTTCTCGGGTTAAAGCTGAAATAAAATTTCTAGCATTACAG
TGTAGAAAGAATGAGGGTCAAAGGTAGAAACATTTTAATAAGAAGGGACCCCTGAACTGT
TAACTTTTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGGCCTGGCTGTCCTGGAACTCAC
TCTGTAGACCAGACTGGCCTCAAACTCAGAAATCCCCCTGCCTCTGCCTCCCAAGTGCTG
GGATTAAAGGTGTGCGCCACTATGCCTGGCTACTGTTAACATTTTACAAGTGCTTAGTTA
GGGGTGCCACCAAGACTGATCTATCCTACCTACATAGGAGTAATGAGAAGTTATGTGCTA
TTTCATATCAATTTCTTGGTCCACAGGCAGAGATCTCAGATGTGGCCCCTGTAGAAGAGA
CCAGGGAGCTGTCACCTGAGCAATCAACAGCAGGTGAGTCTGGGAAAGACTTATAAAAAA
GCAGCTTGAACACAATTGCCCTTAATTTCTTATGTAAAATGTCACTTTTCCTCTGCTGCA
GGTAAGCCATCTGACGGGTCGTCTGCCTTGGATAGAGCGAGTCAAGAGGATGAAACCTAT
GACTTCACCACAGATTATATATAACCGCCACACACTAACGTGCTCTCTGTACGCTGTGTA
GTTTAGTGTATGATATAAACTGTACATCTTGTAAATATGTATCATGTTATAAATTCAAAA
TAAAATACAAGTATTTGCTTGCATGTGTTTAAGATTTATTTATAGCCAGGTATGGTGGTA
CCCAGCACTCAGAAGGACCTCTTTGAGTAAACAAAAAATCTGGGGGGGAAAAAAAGATTA
GGAAAACATTGGGTCTCCTGGAAATAGAATGATATAGTTGTGACCTGATGTGGGGGAATT
GAACTCCGGAAGAACAGCGGTGTTTACATTCTTAAAAATATGGGGAAGTTGCTGGGCGTG
ATGGTGCATGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGATGGATTTCTGAGTTCA
AGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTG
TCTCAAAAAAAGGGGGGGGGGGAGCAAATAGATCTATTGGAAAATGTAGATTTTATTTAC
AAACCAGGCCACAAGGTACAAAGAAAAATGGGGAAGCAAATAGGTCTATTGGAAAATGTA
GATTTTATTTACAAACCAGGCCACAAGGTACAAAACTAAAACCAAACAGCAGTTCCTACC
TACAGCAGCTAGATGCAGTTAAATGCTGGAGTTCTCTGTCCTTCAAGTCAGCAGTATAGT
AAAGCAAACATTTGGTAAGGCAGATGGAGCCGTGGTAGTCATCTGGATATCTATGACTTC
TACCCAGCTGAAGTGTTTTCTGTGGTTGGTATAGAGAAACTCAAGCCCTACAACTGTTAC
CTTCCCACATAGTGTGTCTTCCAGAGTTTCCTGAGTGACGCAATTAGCTTAAATTGTAGT
TCACTTTATGTTTGAGGTATCCATATGTCTTCGGATTAAACTGAATTTTCCTGTTGGGTC
TGGAATATACCACTTTTCCCAAACATCAGCATATGAAGCAGTTCTTCCCCAAGGCTTGAA
GTGACCATTCCAGTGAAGTAACTTGGCAGCTTTTACAAACTGGGGTGAGTACCGTTTTCC
AGCACTGGAACCTTAAATAAAAAGTGCCAAATTAAAACAATGCCATGCTAAGCTGTAGAA
AC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1086, 2149..2207, 2602..2739, 2848..2958, 3108..3188, 3561..3693, 4631..4740, 4989..5109, 5338..5425, 5788..5962, 6220..6362, 6450..6586, 6691..6848, 7226..7292, 7381..7581
1074..1086, 2149..2207, 2602..2739, 2848..2958, 3108..3188, 3561..3693, 4631..4740, 4989..5109, 5338..5425, 5788..5962, 6220..6362, 6450..6586, 6691..6848, 7226..7292, 7381..7460
AY181025.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved