Mus_musculus Locus Tomm20
snOPY snoRNA Orthological Gene Database
Mus_musculus Tomm20
Mus_musculus
Tomm20
8
SNORA14
1849..1982
13040
CAGGTAGAGCACTCATATGCATAAATGAAAAAAAAAAGCATTCTTACAATGAGAGGTGC
AGGAAAGGCTTGCATCGGCTACCTCTTATCACTGTACCCAATTCTCAGAGACTGCAGCAT
AGCTTGTCACTGTCCCAGGTTTCGATGTTTCCTCAGTGAAGGGAGCAGTTGCTGTACCAG
ACTGCCTTTCCTTCAAAAGCCAGCCACAAGTGTGGTGGGTGGGTTCGAGCATTAGTAACG
AGCTGGTTGGGAATCTTGATGGGGGTTGTGGAGGAGGGAGAGAACGACAAGACTGCAGTT
TAATGACGGCACAAATCAGGGCCACCCATAGACTTTTTTTTTTTTTTTTTTTGCCCTTCT
GCATTCCTTACAGGTTAAATTTTTTTGAACGAATTAACCCATTTTTCTTCTCCGCACCAG
GGCTACATCATAAAATTATTTTGCAGTCAATCATTGTGTCTAATCTCAGTCACAACGCAA
TTTACAAAGCAAATACTGCCAGATCAGGCGGCTCAGGTCTTCCTTTAAAACCACAGCTCA
GAGGATGAGGCAAAAGGATTGCAGGTTCGAGGCCAGGGCAGACTACACAGCAAGTTCCAG
ACCCTACTATGCTACAAGGGGAGAGCCCGTCTCAAAAACCTAAAAAGCAAACGCATGCAC
TTCAAGTCACAGGCTTCCTGAAGGACACAGTGAGATGAGATGCTGTTCTCAGCCGGCTCC
CACCTTCGTCTTTCATTAGCAAGGACAGTGGATTAGAGGCTTCTGACTCAGCACGCCACA
AACACGTGCTGCCCCTGACCCCCTGGTCACGGGATGACGCACAAATCCTTCTGCAGTGCA
CGCCCCGCCCCCAGCTTGGCGTCTCAGCCGCGCAGACTGGGTCCATCTGCGCGTGCGCAC
CAGGCGTTCCCGCGCAGGCACCGCCGCGGACAGCCCGCCGCGGACCTTCCCCCGGGGTCC
TCGCGCGCCGGAAGTCCTCGCGCTCGGCCTTTTCCGTCTGGACTGGAGGCAGGCGGCTGC
GAGCGGCCGGCGTGCTCCGATCGGTCGGAGCTAACCGCTGCCAGGCGGGCTGCCGCGGCC
CGGCGTACGCCCCAGTCGAGCGAAGATGGTGGGCCGGAACAGCGCCATCGCCGCGGGCGT
GTGCGGTGCCCTCTTCATCGGGTACTGCATCTACTTCGACCGCAAAAGGCGGAGTGACCC
CAACTTCAAGAACAGGCTTCGAGAACGTGAGTGGGCCCCGCGCGCCCCCGAGTGCTCCCC
GGCGTCGCGCTCTTGCGGCCAGGGTCCCGCCTGTGCCCGCGGGCCTCCATCTTGGAGGCG
ACCTGGCTCCATCTTGCTGGCGGTGGAATGCATGCTGATTCGGGGGAGGGGTAGCACTTT
TTTGCCTTTCCCCAGCTCTGTAATTCTGGGGGATGGGGGGTGGGAGACAGGTCTTTAGCT
CAGGTTAAGGTGGTTATCCTCCAGTTTCAAGGTCTCACCACGCCCAGCTCCATTCCCCCC
CACTCAACTTGTGTTGAAGACAGGGTCCTCCTGTGTAGCTCAGGCTGTAACCCGCGCTAG
CCTCGACCTCGTGGCAGCCAGCACCACCACCACCTCCCCAGCCCCCCGCTTCAACCTAGT
GCTGTGATAACAGGCACGAGCCTTTCTCTATAACAGTCACCGTTGAAAACAATCATTCTT
TATGTGTGTTTACGACAGGGGACTGCTGCAGTTGGTAGGTCGGCTTCGAACTCTTGGTGC
CTCTCATTGCTAGCTTTTCAGACGGGTGCCTACCCCGAAGGCGGTGGTGCTCTATTCAGC
AAACCCGTCGACGGTGCTGCCCCAGCACTAGCACAGTGGGGTGTCGTCCTTGCATTCTTA
AACCCTCTTGGCAGCTTTGCTCTGGTGCTTCCAAGATATGAGTGAATGCTAGACAAAGTG
CGGGGGAGTCCAAAGGGCTGCGCTCCTCACGTGGCTCAGTCTTATTTCATACCTGCGACA
TCTTCAAAGAGTTTTACCGGAGGGAAATCTTGGCACGCCTTGGGAAGTCATGGACATGTG
ATCCACCCATGAATTTACAGAGACTCTTTATTTTTCAATATATAGTCTGAAAGCACATTT
GTTGGAATAATCTGGCCTTTTTTGTTTCGCTTTCTTGGGGGCTGCAGTCAGTCAGTTACT
CCATTCTCTCGAATTTCTAAATGAGTTTTTTAATTTTTCGTAGTTATATATGGTCGGAGA
CTAATGAATTAGACGTACATCCTTTAATACTCATTATAGGACTTCCAGGACTTTTTGAGC
CCGTAGGCCCCAAGTAGCCTCATCGTTTTCTTCACGTGGGGAGATAAGGAGAGTGTGTTT
TTGTCCGATGGCTAGGTAGAGTAATGCGAAGAATGCATCTTGGATTTATAGACTGCGTTT
TGGGGACCAGATTGCGTACTGACCAGCAGCATTCACTAAAAATCTCCTTAACTGTAAAGT
ACGGTGGTACAAGCTGCCTCTTGTTGGTTAGGTGGGATAAGTACTTGACCTACGGAAGGC
TCCATAAATGCGGACTGTTAAGTGTGACTTTTGGGTCCACAAGTCTACTCAGTGTCTTGG
GGCTGTGGGTCTACACATTGGGAGACAGCTAAGCAGGCTGATTGATTCCTTTGGAAAGCC
TTGGTGGAAATCTTGAGAAAGTGGTTTTGGTTGAAGAAATAAGTTGTTTCAGGAAAATTA
TGGTTGTTTAAAACTTTTGAAGCCGGGCGTGTTGGTGCACGCCTTTAATCTCAGCACTCG
GGAGGCAGAGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGGCTACAAATTGAGTTCC
AGGACAGACAGGGCTACCCTGTCTCCAAAACAAAAACTTTTGAGGCAAGCTCACTCTGCA
GACCTGTCTAGCCTGGAACTCAGAGATAAACCTGCTTCAGCCTCCCAAATGGTAGGATTA
AAGGCGCGGCAATAACGCCCTGCAAGGGTGTTCTTTTCAAAATCATCTTTGCAGTATTAA
CTTTTTTGCCCTTCCCGTGATTGAATCCATGGCCTTCTGCAGCCTAGGCCTTCCGCCTCT
GCTCCTCCCTGTGGCTTTCTGTGCTAGACTGCTTGTTTTCTCCGCTTGCCTTTAGTCAGA
ACCAGTTGATTTCAGTGACTTACTGACTGCAGCAGTGACAAGAAGGCAGAGGGAAGCCAC
ACTTCAGAAGTCCTTGGTACTGTTGCTGATCGGTAATTAGTGAATGCTACAAGGTTGGTT
TGTTTTGGCAAATTTTTGCTACCAAGTAGCAGTAAATTCACAAGTCTCTAAACTATGTAG
TTGGGTGATTCTTAAGAATTTGAATAATATGAATTTAATTTTTTTGATGTACATGTACAT
CTGCAATGAAAGGATGGTGTTCTAAGTCGGTTTGCCTTTTAATGAAAAGGGACTTAAATT
TAGGATTTGAAATTAGATGTCTTTTTTTTTTTTTTAAAGATTTATTTATTATATGTAAGT
ACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTCGTTACGGATGGTTG
TGAGCCACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTCAGAAGAGCAGTCGGGTGC
TCTTACCCACTGAGCCATCTCACCAGCCCGAAATTAGATGTCTTAATTCAGATTGACTTC
ATTACCCCCACCCCACCTCCGTTGGTGTTAAGGCTTGATCTGAGGTTTCTAAATACTGTT
CCCACCCTAGGTGCGCCTCATTTATACTGCACACTGTGAAGGATACTTCACTTAGGAATT
CACTAAATATGTGATTTGTTTTAAATAATGGCTTGCTTGGATTTGGAGTGGTTCTGAATT
TAGGCTTTGCATGCTTTTGTTTTGAGACACCATCTCTAATCCTGGCTGTTCTTGAACTCA
GAGATTCCCCTTGTCCTGTGCTGAGATTAAAGGCATTCACCTGGCTTACAGTTTGGCTTT
GTTTTTTGTTTAATGAATATAGTTGTTTAAACTTGGTAGATTTACAAGTGTCTCAGGCTT
ATATCAACACATAACTATCCTTGCTAATTGAATGTGTGACTCTTTCAGCCTGTTTACCAT
TGTGACTTTATTACAGAGGTAGTCTTATGAAACTGAAGGCAGAACTCTAGTCATCCTGTT
AAAAATGAAACACATTAAGGATCTTATCTTTATCTTCTATGTCCATGTCCTGCATTGGGT
AGATGGTTGTGGAAATAAAGTTCATTGCCTTTTTATTATTTTCTCAAAATTCTGGTTTAG
CATATTGTATTTTTCATTCCTTATTACCCAGTTTTGCTTTGTGAGGTGGTTTTCATCCGC
ATGCTGTGTCTTTGGTGATACAGGTAAAGGAAGACAAGGTGGTCTGGAGTCAAGCGCTTG
AGTAACTGCTCATCACTTACGTTTTAGGTCTTAGCCAACAGGTCCTTCAGTTCCAGTTGA
CTCAGATTCATAGACTACTTTAAGGTTTTCAGAGATGTTTTGCTTGGTTGATGGCTTTTG
CTTTTCTTGGCAAGACTGATCTTGGAGAGTTAAGTTCTCTTGCTTACAATTTGCCTATCT
AGTGCATAGAGAAAATGCCTGTCACTTGTACCACCTGGCTGTTGTCTAGGTCATTGTATT
GAGTAATTGTTACTCTCTAGGTATTGGGTATTTAACGATAGGATGCCAGAATGGCAGGAT
ATGAGCCTAGGTTCTCGTACCACATGTTTTACATCTGTTAATTCCAAGGCTGCTGGAAGC
CTCATAATTACAGATACTAGATGAGTTACTGGATGAGTTTTATTGAGTACCAGGTTCACT
CTGGTGTAAGTGTAAGGCACTGAATATAAACCTGGCAGTGATCCCCATAAGCTAACAATT
CTTTCTTAGGGCATACTGTTGCAGAGCACCGAAGCCATTGTTAACTAACCAGCCCGTAGT
TAACAATTTCGGGATGGGGCTCAACCTCTTGCCCTTCTCTTTTGGTCAAATGTGTAAATA
CTGTTGGGACTAGTAGCCTGCCTGTAACCCTGCACTTGGGAGCTGAAGCTGTAGGAGCCT
CAGTGTTGTAAGCCTGAGTGTGTCACAGAGCTTGTCAATCAAATGTCTTACTTTTACTGA
ACCATTTGGCTTAAGAAGGGATAGATTGCCGGGCAGTGGTGGCGCACGCCTTTAATCCCA
GCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGGCCAGCCTGGTCTACAAAGTGAGTTA
CAGGACAGCCAGGGCTACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAGGGGGGGGA
TAGTTTTTTTGTTTTGTTTTGTTTTTTTTTAATAGTAAAGCTGGAATCTGTATATTTCAG
TAATAATGGCTTAATTATTTTATTTAGAAAGGGGGCTTTGTTCTGCTGCTGCACAGCTGT
TGGGACAGTCTCTGTCTTCTGAATTGTTGGACCTGGGGATGCAGAAGAAAAGAGAAAGAT
CCTACCTAGAAACACCAGTTCACTCGCCAGGGAGGCAGGGATTCTGGAGGCAGGAACGTT
TTGTAGAATTAATGATGGTTGCAGCAATTAGATGTCTTGATCCTTAATGATGATAGCCAA
GTTTTTAATTTATTTTTCTTGTAGGAAGAAAGAAACAGAAGCTTGCTAAGGAGAGAGCTG
GGCTTTCCAAGGTAATGAAAATAGTCTTGTGTTTTTGCGTGTAGATTGCATGCTCTCTAA
GCCTCCTGTGTTTTCCTTTGGTGGTGGTAAGAGCAAATATGTTAATTGGGTAAGCAGCAA
GATGAGAGTCTCCAGAGATGGACATGAAGAGTTAAAGTTCTCGGCTACTTAAAAATGGTT
TTAAAAAATACAGCATTTGATTGGATTTTCCTTTCTTCCTTCCGACAGTAACCTTTAATC
CTAGTTTGAGAAGCTCTGTTAGAGGCAGCCTGGGCAGCACAGTAGCAAAAGAACCACGTG
TGTTAGTCCCACAGATCTTTAAGGTTTTTACACCTATGGATCAGAATTATATCAGGTTCT
GACATTTAAAAAAACAAATTGTAATTTGTAGAATATAAATTTTCATTTTTTTCTTTTCAT
AGGTCCTTAGTTTACAATTTTTAATGACTGTAGGTTTTTATCTACTTAATTAAAAATATT
CAACTTTCTCTCTTGCTGACACTCTGGATTTATAGATGAAGTATTGGATCACTAATAGTT
CTTTTAGAAGCACACTCAGGCAAGCAAAAATGGTGTTGATAAATGCTACACTTTTTTGAT
ATTTTGAGCCAGTTGAGTGATGAGCATAGCTGGCGGGATACGTGTGGTTCTAGTGAACTG
AAGCTGGGACCACTTGTTTTTTCCAGTGTGTCCAGACTGCCTTTCCACCATGTGGGATAT
GATGAGGAGACAACTTAGGATCTCTGTATGTGTGAGTCTGACAGGAAGTGTGTATTATTT
AGAATTTTAGAGGTAGAAAGGGAGTTTGTGTGTGCTAGGCAAACTTTGTACCTCTAAGCT
GTACCCAGGCCAGCCTATAAGATCCCTGCAAAAAGAGGACTGGTGATCTAGCTTAGTGGT
AGAGCGCTTTTCTAGTATGCAAGGGGCCCTAGGTTCAATCCCAAGCACCACCCATAAAAG
TTTTACATCTGTGTGAAATATTGTTAAAAGAGTGAATGGATGATAGTTTAATAGTTTATA
ATGGCAACAAAATAGCATTGTATAGATGATAGAGAGGTATAGGTAATATTATAAAGGCCT
GTATAGATGTATAAACTACAGATATTTGTATGCTTTAGCTTTCTCTAGGTTTTCTTGATT
TAGGAGGTTTGCTCCTAGAATGAACTCATTTTATTTTTAGTGGTTTTCTGTACGCTGCTG
TATCCTCAGCTTAATTTCTGTATGTTTCGTTTCCAGTTACCTGATTTAAAAGATGCTGAA
GCAGTTCAGAAATTCTTCCTTGAAGAGATACAGCTTGGTGAAGAGTTACTAGCACAAGGT
AATTGTCATTTCAGGATAAACACTCAAGGTGGGTTTTGGGTTCTTTAGGCTGAGGCTGGC
TCCAGAAGGAAACTGGGTTGCTGTTGCCAGGCTGTGTGATTGAAGTGAGTTTTACTTGTT
CTGACATCGGATGTGGAGGATAGGTAACATTTGAGTGAAATCAGAAGAGGACTTTATTTT
TGCAGAGATGACTCTCAAGTCAGTCAGGGTGTTTGGGTGTCTCCATAGTGCAGAATAAAT
AGTAACTGAATACGGCTGAGCCTGCCAGCCCTCACCTAGTCCAGGTTGTTCCAAGGTTGT
AGGAAGGAGTGGCTAATAAGCCTAAAAACAACGTTGATTTGCCTAATCAGAGTCACAGTA
TATTAGGGTTCTCTAAGGAACAAAATTCACAGAACGAATTCATAGAACGTTTGTGTATCT
GAAGGATTTATTACAGTAGCTTTTTAGTGTCTGACTAGTCCCAACAGTGGCTATCTCCTA
ACTGCTCCTAGAGATCTCGCCTTGACACTTCCCGTTGAGCATTGAAATCGTAAAGAAGAA
TGTTTTAATACCATCAAAGGGGTGGCTTGGGATAGATGAGCTTGTCAGTGAGAGTGAGGG
CAAGCAAGCAGAAAAGCACAACTCTCTTCTTTTTGTTCTGGGTGGCCTCCAGAAGGTAAG
GCCTGAACTTGGCTCTGACCTAACCAGTCCAACCAAGAAAAATACCTCACTGATGGACTC
AGCTGCTTGGGTGTTCAGTTACTTTCCAATGTAATCAGGGTTACAACCAGGATTAACCAC
CACACCAGGTATTGATAGCTCTTCAGATCTGGTTTTTGTTTTTGTTTTTTGGGTTTTTTT
TTTTTTTTTTTTTTTGTTTTGTTTGTTTGTTTTTTTTTGGTTTTTCGAGACAGGGTTTCT
CTGTGTAGCCCTGGCTGTCCTGCAACTCACTCTAGACCAGGCTGGCCTCGAACTCAGAAA
TCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCCT
TGTTTGTTTTTTTCAAGACAGGGTTTCTCTGTGCAGCCCTGCCTGTCCTGGAACTCACTC
TGTAGACCAGGCTGGCCTCGAACTCAGAAATCGCCTGCCTCTGCCTCCCAAATGCCGGGA
TTAAAGGTGTGCGCCACCACGCCTGGCTAGCTCTTCAGATCTGATCAGTTATGTGATCCA
GATTTTAGATAATTACTTTGGGCCTCATTTACTTGTATTGAAAGGTGATTTTGTTTTATT
TTTTGTTCTAGAATTGGGCAGCATTTTGTTCCATACAATAGAATGGTCCCATTGTTTAGT
AGTTTTTAATCTCAAAAGTAGTTTTGAAGTTGTTGCTATCATTAATAAAATTGGAATTGT
GTCTCTGGACAGTGGTAGCACATACCTTTAAGCCCAGCACTTGAGGGAGAAGCAGGTGGA
TTTCTGAGTTCGAGGCCAGCTAGGGCTACATAGAGAAACCCTGTTTGGAGAAACAAAACA
AAAATTGGCATTGTGTTATTCTTGGGTTTTTTTCCCCTCAGTAGATTCAGATGGAGTTGA
ACTTGATGTATAATGTGTATTTATTTGTGTTCTGTTTGTTTTATGAGGAAAGTTTATGGT
CAACTTTACCCTTTTAAAAATTAATTTTGTGGGCTGGAAAGGTGGTTCAATGGTTGGAGC
ACTGGCTGCTCTTGAAAAGGACCCAGGGTCAATTCCCAGCAGCCACCTGGTGGCTCTCAG
CTGTCTGTAACTTTAGTTATAGGGCATTCAGCATCCTTACACAGACATGAATGCAGGCAA
AACATCAAAGCACATAAACTTTAAAAATTGTATGTGTGAATTGCTTAAGTGGAGGTTAGA
GGGAAGTCTTGCAAATGTTTCTCTTCCACCTTTATGTGAGTCTGGGGATTGAAGTAAGGT
AGCCATCCACCTTGACTTGCTGAGCCACCTCACTGATGTCCCCCCCCCCCCCATTTATTT
TTATGTTTCTTTCCGAAGAGAAAGTTTCTCATTGAGTTTGTTCAGTTGATTTCATCAAGA
GTTGGAGGTAGTTCTTATATTCAAATAACTAGCAAACTTTTAATTTCCACGCTTTTCCTA
GATTAAGAGCAATTGAGAAGAACTAATCAGAAAGTGTTAAGTGCTGGAAATAGATACCAT
CAGGAAGCTTTTCCAAGATGCCCTGCAGAGGGCCAGCCAGGCATTGTGTGTTCTCAGAAC
CAGTTCATCAGCACTGTTGGTTCAGCAGAAAAGATGGCTGTTGCCAGTGCAGGTTCAGCA
GAGACCTGGCGTCTTCTGCATCAGTGCCTGGCCCTCAGGGGTTGGTTCTTCTGTGGCCAT
CCTATCTCCTCCGTACCCCAGGAAAGGAGCTAGGCATGTATGTCACAGTAAGGGCTGCCC
AAAACCAGATGACAGTCAGGTGGTGTCTGATTTGTATAATGGGATTAGACGTAATTCCCA
CAGTGACAGCAGAGATTTGGCTATTTCTGACCAAGCTTGCCAGGCTGTGAAAGCTGTGGA
TGCTGGTGCCTGTCTTTGCACAGCTGTCAGTTGAAGTGTGCTCATTTCCATGGGTGCAAA
GAAATTCTGTACCAAGTTTTTACTTTCTAGTGATTTGGACTAGGACCAATTACTTGGTGA
CAAAATCTTGATGGCTTCAGATAACATGCAGTTGTGTGTGTCTGCAGGTGACTACGAGAA
GGGTGTGGACCACCTGACAAATGCCATTGCTGTGTGTGGACAGCCTCAGCAGCTGCTGCA
AGTGTTACAGCAGACTCTTCCGCCACCAGTGTTCCAGATGCTTCTGACCAAGCTTCCGAC
CATTAGTCAGGTAAGGAGGCGAAGTGCTTCAGGGTGACACGCGAGTTGATTACGAACTCC
ATGCTTAGGGGCAGGTTTGCCGAGCATGGAGTTGGATATGCCAGTCGTGTACTAGCCTAA
GGTGAGTGCTTGTCAGATGTGAGTCAGAAGTGTAGGTGCTCTTGTCAACTTTACGTTTGA
GTCCCCAAATTCGGCCTGCTCAGGTGCTTAGGTGGCCTGGCAGAGGATACAGAAGTCAAG
ACTGCACAGCCTGGACTATCCTGAGTCAGACTCTGTCAGGCTTGGTGTTGTCTGCCATTT
TTTCCTGCTGTGGGCTTTGAATTTTGTGCTGTTTGACTGTATCACCATATTTCTACTTGA
AAGTTCAAGGTGCATGTTTCAAATGATGAGTGTAGTTGAGTGTGATAGCCCATGCCTGTA
ATTCCATCACTCCAGGGGCAGAGAGAGGACGGTGGGTCACTAAGCCAGGGCTGCTTAATG
AGTTCTTGTCTCAAAACATAAGGTACAAATTGACTAAACATTCACTAGAGTGAATTCTTT
CTGAGGAGTCCAAAATGAATCTCAAGGGCTACTGCATCATATATAGTTAAGAATTAGCAA
AGTGATGGTAGCAAGTAAGTTTTCATAAAACTTTTTAGTAACTTGTTAGTTTTTTTCTCT
CATGGTATTCTGTCTTCCTTGTGTTAGGCTTTACCACTGAGCCATGTTCCTAGCTCCGTT
ATACTCAGCTAGAATGCAAGAGGCCTGGGGAAAAATTAAATTCCCCCCAAAGATTTGAGG
AAGACTTAGAAAAACAAGAATTTGAATGAAATTTTTTTTTTTAAGATTTATATATTATAT
ACAGGGTGTTCTGCCTGCATATATGCTTGCATGCCAGAAGAGGGCACCAGATCTCCTTAC
AGATGGTTGTGAGCCACCATGTGGTTTCTGGGAGTTGAACTCAACCTCTGGAAGAACAAT
CAGTGCTTTAACCTCTGAGCTATCTCTCCAGCCCAAACTAAATCTTTCAAAGTTAGATTA
AAATGGTTCAGTTCTGTTCATGCCTCAGTTGATGCTATGTGCTGTTAAAGGGATAGCTGA
CTCTGCCTGTACTGTGTTGCTATAATCAAAATTCCAGGAATGAATAAGAACAGATTATTT
GCCTGCTGTGTCTATATGTGACTAGGAGTCACCTGGCTGTGTGACAAAATCAGAAAAAGA
ACCAGCAATGTGCAATCAAGAGCTGGTAGTTAGTTGTTCAGAAACTGATCCAGTTGGAGA
GTGGTGCTGTCTTAGGGTTTTATTGCTGTGAACAGACACCATGGCCAAGGCAACTCTTAA
ATATTTAATTTGGCCTAGCTTATAGGTTCAGTTATTATTATCAAGATGGGAACATGGAAG
GACCCAGGCAGACATGGGCTGGCTTTCAGGCAGCTAGCATGAGGGTCTTAAAGTCCACAC
AGTCCGTGACACACTTACTCCAACAAGGCCACACCTCCTAATAGTGCCACTCCCTGGGCC
AAGCACATACAAACCATCACTGGCACCTGAGCTTCCAGTACAGGGAAGCTTTGTTGAGAA
CAAAGCATGTAAGCTACACACAGATTTTGCTGGATGTTAATTTTGGCATGCCGTATTCCC
TCTGATGGTTGCAGGCTGGAAAGGAAAATTATGAAGTATAGACAGCTTTGTAAGGGCTCT
CATAGATGAACAGCATTGTGTCATGTGTTTGAATTTTCATGTGGAACTAAACTTTGTATG
GTCATACCCCTCCCTCACCACCACCACCAATCTGACCCCCTCTCCTTATGCTCAGCGTCT
CTAGTGCTGAGGTTTGAGGTATGTGTCACCATGCCCACCTGATCTCTGTCTTCTGAGATA
GTAATATGAAGTATGGGATCTATGTCAAAATGGGGGAATTTTATTTAGCAAGAATTGTTT
CTTTGAATATGAAGAGCAATTTAAGTTAAAATTAAGACACTTCTCAAAATTAATTTTCTT
TTTCTTTCAGAGAATTGTAAGTGCTCAGAGCTTGGCTGAAGATGATGTGGAATGAGCCAG
ATACCAACAAGATAAAATCTCAGTAAAATAATTTAACAGTTAGCTTGGAAGCTGGTCAGC
TCTGGGGGATTAAGGGCAAATTATGCTGTCATGAACTGTCCCACACTGACGTCTGCCAAA
GCGAATATGAACTTTGGTAGATCCATTGTCTGTTCTATTTATTTTTCCAGTGAAAAGTAT
TTTGATAGAGCTTTTCATTTTATAAATACACTGAGTTAACCAAATATCATGGATTTCCGT
TTGTTCTTAAGACATGCAATTCAAATGTAAATACAGTAGAGTATTACTTAGGTAGAAACT
CGTGGTGATTTTAAGATTGGAAAAGAATCTGAGGAAGAGTTGAATAACACACATTCTAAA
GACTAGAACATTTTATTGTATGTTGTAAAATTGGGTAGAAATTTGTGTTTGTGAAAACTG
AGCATTAAAACCTTACAGAGACCGTTTCTCGTTTACTTAAGAAAATGTGCGGTGTGTTGT
CTGTTGTTAATTCCATTCCCTCCGTGTGTTTCCTTAAAAGCTTCTGTCTATTAGTGGCTT
CCTGTGCTCTGGGCACTTAACTCCTAATCTTTCAAACACCGGGATGCAAACAGCACAGGG
ATTAGACCTGTGTGCACCCTGACCTGGAGGGTGAGCTTTGCCTGCTGTCTGCTCGCTTGG
CTCTTTATACAGACTGAGGCTCAGTCTGCCTGCCCGTCTCTGGGGTGTTCCATCTCAGCA
TTAGGTCAGTTGGTTCTGTTGAGTGTCTTCAGGTCCACCTCCAGCTGGTGATTATTTCAG
AATAACCAGACCTTGTACTTGTTTATATTCTGAATTTGCATGTTTGCCTGACTTAGTATT
TCTCAATTAAAACCTCTTAAGTGGAGTAATTTCTTTGTCAGTTGCTACTGATGTGAAGTG
ATTCTGTTACTGTTGTGTAAATTAACCAGAAACTCATCCTTAAGGAAGCTGGGGTGGTCT
TCTTGTGCAAGTGTTTTTGCTTTTAACAGAATTATCTCTTCAGTTCTACTATGGATTGAT
TAATTTATCTTACACAGTGACAGCGGCGTGCCATCTTGACGGGAGATCTTGTGGTCTGCT
ACTATCTGTTCACCAAGCAGCATTCTCACAGGACAGCTCACTTGCATCAGTGCTGTAGAC
TTGTTTGCTTGGCTGTCCTCACCTTTGCCTGGGTCAGTGTAGTGGGAAGAATCTGGAAAT
GGAGGTTTAGTTAGCTTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1225, 5604..5650, 6876..6957, 9647..9789, 11770..12040
1105..1225, 5604..5650, 6876..6957, 9647..9789, 11770..11811
XM_001472757.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved