Mus_musculus Locus Rpl13
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl13
Mus_musculus
Rpl13
8
snoMBII-202
1617..1699
4819
CAACCATCGGTAATGGAGTCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTG
TACTTACATAAATAAAATAAATCTTAAAAAAAAAGGAGAAGAAAAAAAAGAAAAGAGGGT
TTAAGTTGCTCAAAAAGCATTGAAATTGCTATTGTCCTGTCTCATTTTCTAGATGAATTA
TGATTATGGTCCTGTGATATCTGGCCCGGGTATAATGTGGATTTTTAAATTTATAGCCCT
CTTAATTACTGAGCCATTTCTACAGCTTCTGTAGTGGAATTTTGATCAGGAAGAAACCTG
GTAATTGGGAATGAGGAGTGAAAAAAGGTTATAGGCATACAGGTGTAGGACCAGTGTATG
CCTTGGCTGTTTTGTTGTCGCTGCTACTGTGGGTAGGAATTCAGTATTGTATTTCGTCAC
ACCTGATTTCCCCCCGAGGAGTTAAGTCAGGGCTAAAGGAGTTATCTAAGTAAATGGGGG
AGTTTGGGGCTGGAGAAATGACTCAGTAGTTACGATCACTGGCTGCTTGCTGTTTCAGAA
GTTCAATTCTCAGCACCCAGGAACTCCGGTAGTAGGGGATCCGACGCACAGCCATGAAAC
CAGGGAGACACTCATACAAATAAAGTAAAAATAAATAAAAATCTTAAAGTGGGGGGGGAA
GTCTGGAATGGGGGTGCGTGCTTCAGTTCTGGGGAAACATAAATTCCAGGCAAATCTATA
ATAAATTTTCCTGGGTGGACGGGGAAAAAACACTGGATCTAGGAGGGAGAAAGAGTTTTA
GGGGTTTAATTCATAGGTGCGCCCCTGAGCACGCCGGAGATACCCACACTGCGAAGTTAG
GAACCAGCGAGAATAACCAACCCGACGGCTAGAAAGGCGATGGTCCGCCGGCGGGCGGGT
TCGCGTGACGTCACTTCCCTTTCGCCTGATTTTGATTGGCGTTTGAGATTGGCCGGACTC
CCTACAAGCCCAGGGTGCTTTGCGGTGCCCGGTCCTTTCCGCTCGGCCGTTCTCCTGTAT
AGGAGGTGAGTCTCTGCCGCCGCCGGTCCCATCGTGGTCCATCGGGCTCCATCGCCCTCC
ATCCGCTGTCATCGGCGAAGAGAGGCCGCACGGACAGCCATGGAGGAGCCCGGGCGCCGA
CAGCACGGAGCCAGGGCAGGGGCGGGAGGACCCGGGACGGGGTTGGGGACCCTGGCCTTG
ACTCGCCGCCCTCCTCTCCCTCGCGGCCTTAGGCAGCCATGGCGCCCAGCCGGAATGGCA
TGATACTGAAGCCCCACTTCCACAAGGATTGGCAGCAGCGAGTGGACACTTGGTTCAACC
AGCCGGCGCGCAAGATCCGCAGGTATAGATCGCGCGTGGCTCGCGTGGGCTCCAGGGCGG
GGACGCGCGTGGGGCAGGAGGTGACGGCTGTGCTTTTCCTGCAGGCGCAAGGCCCGGCAG
GCGAAAGCGCGTCGCATCGCCCCTCGCCCCGCGTCCGGCCCCATCAGGCCCATCGTGAGG
TGCCCTACAGTGAGATACCACACCAAGGTCCGGGCTGGCAGGGGCTTCAGCCTGGAGGAG
CTCAGGGTGAGTGCGGCAGGGCGAGGTCCCTTGGCAGGTCCCTCGGGCTCGGTGGAATGA
TGACATTCTCCGGAATCGCTGTACTGACTTGATGAAAGTACTTTTGAACCCTTTTCCATC
TGATGACACCGAGTTTTCTCGGCAGGGCCGGCTTGGGGTGGGGTGACTGCGAGGTGGGTG
ACCAGTTTCTGTTTCTGAACAGGTGGCTGGCATCCACAAGAAAGTGGCTCGCACCATCGG
CATCTCTGTGGACCCGAGGAGGCGAAACAAGTCCACGGAGTCACTGCAGGCCAACGTGCA
GCGCCTGAAGGAGTACCGCTCCAAGCTCATCCTGTTCCCCAGGAAGCCTTCTGCTCCGAA
GAAGGGAGACAGTTCTGTAAGTCCTGCGGGGCGGCAGAGGTCCGGCTCAGTGTAGATAGA
GTCTGTGTTCTTGGATCCAGCTCTGCAGAGTTGACATGAGTGCAGCAGTGGGAGGTTAGA
GCGTACTGGGGGCGGCGGTGACGCGTGCAGATCAGTGGGAGCCACTATGGTGTCCCTGGG
CTTTCCAGTGTCTGTTAGTGTTGGGAGCTATTGACTTGGAGCCTGGTATGCTGTTCTAGA
GCGTTCACCCTACCAGGACGTTCAGGGGCATCTCGGTACAGAAAGTATCTCGGTATTCAG
AAGTGTAAAGAGTTTTGTAACAAGGATCGGTGGGTTTCTTGTCAGTGTGGGCTTCCTGAG
GGTGGGGTAAGGATGGCTTTCTTCTGTTCCTTCAGTGGAGCTGTAGTCAGCCAGCGCACC
GGGACGGAAAATGCTAGGTGCTGCAGGCCCAGGCAGCCTGATCCTTGGGAACTAAAGCAG
ACCCCGTGATAATGGGGTCTATAAGTAACAGGCATGAGATGGAAGCTGGACTCAACTTTT
TCTTACTCTTAAAACAGGCTGAAGAACTTAAGCTGGCCACCCAGCTGACAGGACCTGTGA
TGCCCATCCGGAATGTAAGTGGACACTGCTGTAGGCTCAGCTCCGTAATAGACAAGATTG
GCAGGGATAAAAAAGTGTGTTGTGACAGACTAATTAGAGACTGGTGAAGGTTTCAGGCTG
GTGAAAGAAAGTTCTCTTACCTTGGGGACAACCTCCCAATCTTTGGGGTGGGGGGGCACT
TTTTGTTGTTTTGAGAGAAAGAGATTCTCTGTAGCTTTGGGCTGGCCTTGAACTCAGAGA
TTGACTGCCTCTGCCTCCCAAGTGCTGGGTTTACAGGCATTCATTCATTACCACCATGGG
CTAACTGCCAAGATTTTAAAGGACTGGCTTGTGTTCCTTTTAGAAATGCGCAGGTCCCTA
ACTTAGCATTCCCTACTTGTTTGGAGTGCTTGGGAGTGTAATTTTGTTCTTCTCTGAAGG
GATCAGGCTTTGTGTCTTGGGCTTTCTGTTGCTATGAAGAAGTGCCATGACTAAAACCAA
GTTCTGGCTTACACTTGCACCTTGGAGAAAGTCGGGGCAGGAACCTGGAGGCAGGAGTTG
ATGCAGAGGCCATGGGGGGGGAGACGTGCTAGGTGCTGCTCTAAGCACCCAGAGCCTCCA
GCCAAGGGTGGGTCGCCCTGTGCAAGGTGGCCTGCACCCTCTCACGTAAATGAGAACTCT
CTCACAAAGAGGGAAAGAGACATCAGTGTTCCTCTGCAGCCTTTGCTGTCCTGGAACTCA
GTACACCAACCAGGCTGGCCTCTAACCCACACCTGCATCTGCTTTGAGGGTTAAAGGCAA
GCCCGATCTTATGAAGGAATTTTCTCATTGAAGTTTTTTCTTCTGCCATCACTTTGGCTG
TGTCAAGTTTTAATAAATTCACCAGAATGTGCCTTACAGAGGTTGTGGCTCTAATTTTAT
AATATATATTTCCATATATAAGCCAAAGCTGGTTTAGAACTTAATTTGTAGTCTATGGTG
GCGAAGACTCAGGATTCTCCCATCGCAACCTGACAAATAGTGGGGATTTACTTATCCCAG
GGGGTGGTTCTGCGCCCGGAGGGCTGAGGCAGTGAGTCCTGTGCACAGGTCCTGTAGGCT
CCTGACTTCTGTTCTCTTTCCAGGTGTACAAAAAGGAAAAGGCCAGAGTTATCACAGAAG
AAGAGAAGAACTTTAAGGCTTTTGCCAGTCTCCGAATGGCCCGTGCCAATGCCCGACTCT
TTGGCATCCGAGCAAAAAGGGCGAAGGAAGCTGCAGAGCAAGATGTTGAAAAGAAAAAAT
AATTCTGTGTTGGAGAGCTGCAATAAATTTTCCATAAAGCAAAAGCTGGGTTTCTTTGTC
TTTTTTTCTTGAGCAATAGTTGTGTGTTGCAGGTTTGAGTTAGAAGGTATTCCTAAGAGA
TGTGATTGAGTTTCAGCATTTTGGGCCTTAGTTATAACTGAGTGGGTGGGAGACTGCTGT
TAACACCAGCTGCTGAGCTCAAACGTCGTAAATGCCATAGCCCAGCCCTAAAATTAACTT
CAGCAGGGTCTTCCTTGGGGTGGTCGCTGTCTACTGTATCAGTAGCTGTAGCAGGCTCTT
CTAACTTAGCCCAGAGGAAGGCTGGTGCCTGGATTTTGTAGTAACTTGCCCCTCTCTTCC
CTGGTGTGACAGGATTAGGTTTGCCCCGACAGTGACTTAGAACCATGGGAGTCCTGTATT
ACCCTGCATGTGCAGTGCCTGTGGTGCCTGAGGCATTCTTACTACATACAAAGAGGAGAG
CCCCAGAGATAGGTTTTGGGGCCTGAAGTTTTTTCTTTTTGGCCCAAGCATTCTTCAATA
CCTGCCTTGTCCCCCAAGCAGTAAACCACTAGAAAGCACCCTGGAAATGGGTCCCATGTT
TGAAGGATTGAAGTTACTTGGAAGAGTAACGGGGGTAACATGCCTACCAGTTCGAGGGCA
CCATGCTGTGCCCTAGGAACAAGATATATAGGATGGCCAGGCATTGATGGCACACACCTT
TAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTTTTAGTTTGAGGCCAGCCTGGTC
TACAGAGACATTCAAGGCTAAACAGAGAAACCCTGTCTCAAAAAAAAAAAAAGATAACCT
AGGATGGTGCTAGACTTGGTCATATATGAATGTCCACAAGGGGGCAGAAGTTTTTAGTAC
AGGTATGGTAAATGTGAAATTTATTTGTGTTAGGCCTTGATATATGTGTTGTGTACAAAT
CTGAGAAGGATTTAAAATCGTAAGATACCATCAGGAAGTCTGGCCCTCTGCAAGAGCAAG
TGTGCTTAACCACCCACCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1232..1341, 1424..1565, 1762..1935, 2477..2533, 3623..3819
1238..1341, 1424..1565, 1762..1935, 2477..2533, 3623..3778
NM_016738.3
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved