Mus_musculus Locus Rpl18a
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl18a
Mus_musculus
Rpl18a
8
SNORA68
2526..2656
4036
CTCAGGCATGCAACACCACGCCCAATTTCTAAATCTTACAACTATCTTATGGGACGGGG
AGTGTTAATGCGGCTGGGGAAACTGAGGGATCACACTTGAATGCGCCTGAGCACAATGGA
AATGGGGGACCTAGAAGCACACATCCCAGCATTGCATTGCGTTGCGGCTGAGCCAAAAAA
CGCGCTCGCCACCTAGTGGCCATTAGCGGAAACACACGGCGGATATTGTCGCCTTCAGGT
ACAGGACCTGGCCAGGAAAATGACAAAGTTAAGACAGAGTGACACAGCTCTGATACAATT
CTATAAAGAAAATAGTTACGTGGGCTGGCAGGTGGCACACTCCAGCATCCCAAGAACTAG
GAAGAGGCAGGAGAATTACAGTGAGTTACAGGCTAGTTTGGGCTACATTATCTCAATAAA
CAGTAAAAAACAAACAAACAAACCAAACTAATGACAGAGAAAAAGATAGATGGGGCTGGA
GAGAGAACAGCAGTAGCTAAGAGCACATACAGGGATCGATTCCCAGCATTCACCTCACAA
CTTTTAACTCCAGCACTGAGGAACTGACGCCCTCTGCGGGCCTCCGAGGCACCAGACACG
AAGGTGGTGCAAGCAAATAAAAAAGATGGATGATGGGTCATAGATGGGTAGATACACAGA
AGGATGATGTAGAAAGTGGGAAGAAAAAGATGAAAAAAGAGAGAGACAGAGAGAACTAAA
AATCCGGAATCTAACTAGGAACCACGATTACGCGTAGACTCCCAGGATCCCTCGCGCACG
ACGATGGGGCGTCCCGGGAGAAACTTGCAAAGGCCCGTCGCGCTGCTCTCTGGGAACTGT
AGTCTCCGTGAAGAGAGGCGGGACTTATACGTAGCTGATCGGTACCCAATAAAAAAGCCA
AGAACTTAGACCGCTACTAGCTGTACCCAATGGAAGCACCGCATCAGGAGGGCGGGACTT
CCGTCAGAGACCATGGTGAGAGCCTGCGCGAAAGACAACACTTCCTTTTGTGACTGGCGG
TGAACGAGTGCGCAGTGCCATGAAGGCCTCGGGCACGGTAAGGAGGCCGCGGCGGGGCAA
AAGGTGCGGCGTTGGCGGCAGGGCCGCTCGGGTTGGCTGTGTCCTCCGGGGTGGTGGTGC
GTTCGTCGCGAGGGTCCCTCAGCGGTTACGGGCAGCTCTCCTCGCCCACAGCCTCCTTGC
GGCCAACATGGCGGCCGCCGCGTGCTGGGCGGCCGAGGACGGAGCGGGTTAGATCGGGGT
GCACCGGAAGGCCCTCCGCCTTTTCGTGTATATCAGCGTTACACTCCTTTTCGTTGCCAA
ATCTAGCCCCGTGGTTCTTTTAGTCTTTTTTTCCTTCGAGACAGGGTTTTCTCTGTAGCC
CTGGCTGTCCTGGAACTCACTCTGTAGACCAAGCTGGCCTCGAACTCAGAAATCCGCCTG
CCTCTGCCTCCTGAGTGCTGGGATTAAAGGCGTGTGACACCACGCCCGGCTGGCTTGTTT
TAGTCTCTTATGAGGTTTAAAGCTAACCTGGTCTATTTAGACTGGAGTGGACACGCGGCC
CGCCTTAGGTTTAGAGAGCATTTGGTAAGCTTGCGGCCTGTCCCCAGCGCTGGCTACACC
GAGCCTGCTGCCACTTATCTCGGCACTTGAAATCGAAGCAGAGCGTCGCTAGAATCATCC
TTAGCTAGTTCTAAAGGCTGGCTGACGGTAGCCTAGGGTGCCGGATCTCATACTGGCCCC
GGTGTGTTGGACACAATCCTTCGGACTCTTGGTGAAAAGCTAGTCTGGAATCGTCAATTA
GTCCCAATCCAGAGACAGTTTCTCTGTAGAACAAATGGCCTTTTTCCTGCTCTGGGATTA
AAGACGTGAGCCACCTTTGCCATCTTGGCCTGGAGTTTCAGGGAGAGCAGAGCAGCCTGC
CACATGTAGACCCTGAGGCAGCTTCGTAGCGGAGCACAAGCCTTCTGACTTGCCTCACAC
TGGGCTCGAGTGTATGAGCCCACTTTGGACACCCCTGCCTGTGGGAGGACTGAATCTCAG
GCCGGCTCTGCCTCCACACCCCTCCCCCACATAGACAACTTTCTCTCCTGACATGTCTTT
CAGCTTCGGGAGTACAAGGTGGTGGGGCGCTGCTTGCCAACCCCAAAATGCCACACACCA
CCACTGTACCGTATGCGAATCTTTGCACCCAACCATGTGGTGGCCAAGTCCCGCTTCTGG
TACTTTGTGTCACAGCTGAAGAAGATGAAGAAGTCATCCGGGGAAATTGTGTACTGCGGA
CAGGTGAGGTCTGGGGCCCCACAGGATGCCGGTCGCTGGGTACCATCAGAGCCAGGGCAG
CACTCCTCATGTCCTCCCTACTCCCCACAGGTGTTTGAGAAGTCACCCCTGCGTGTGAAG
AACTTTGGCATCTGGCTGCGCTATGACTCCCGCAGTGGCACACACAACATGTATCGGGAG
TACAGGGACCTGACCACTGCTGGTGCAGTCACACAGTGCTGTGAGTCTCCAACCCTCTGC
CAATTTCTGGCACCCAACCCAAGAACTGTCGCTGCCTGTAGCGGCTGTTTAAATAGTGGT
GCACACAGCAAAGGGGCTTCGTCGCCTTTGGGGGGCTGTGCAGTGCCCCCCAGAGTGAAT
CAGTAGGCTCTACAGAATGTGGGGGCATTCTGGGTGGCTGGGGCTGATTTTCTTTTCTTT
CCACAGACCGAGACATGGGTGCCCGACACCGTGCCCGTGCCCACTCCATCCAGATCATGA
AGGTGGAAGAGATTGCAGCTGGCAAGTGCCGCCGGCCAGCTGTCAAGCAGTTCCACGTGA
GTGACCCCGAGTGTGGGGCTGACGCAGGGCTGCAGGGGGTGGTTGCACACGGACAGTCTC
TGGACACTGATTGCTTCCCTCCCCACAGGACTCCAAGATCAAATTCCCACTGCCCCACCG
TGTGTTGCGGCGCCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTCTA
GACACAGAGACCCACTGAATAAAAACTTGAGACTGTCCTTGCTTGTTTGCTTCTATGTCC
CTGGAGAGGTCCCAGTTGGTCCCGTCCCTAACAACATGCTAGCCCTGCTCACCTGCCTGT
CAGCCTTGCTCAGTGGCATCTTTCCATAGGTGTGTATCCCCTTAGATTAGCTTCAGCCCC
ACTACGATTTGTCTAGGACATAGCCTGAGCCCTGCCTGTGACACTGAGGGGTAGCAGTCT
GTTTCTGGACTCCAGGGTGCTGCTGTCTCAGGCCTAAGAATTCCAGACATGACTATAATC
CAAGCCTGGGGACCTGGTTGAGCTTTTTATCCTGCTGGCTCTAAGCTTCAGCTAGGTGGA
AATGAGGCCAGCCAAGCCCCACAGTGAGCTTGCAAGCTTTAGATGGGGACAGGGTTACGC
TTTGGTGAATGATGGAGGAAACATGGGGGTTCCTTTTGTTGGGTGCAGCCAGCACGGCAT
CATCATGGTGCCCAATCTTGAAAGGGCACAGGCCTGAAGCTTCCTGGGACTGTTCTGTCA
CAGGGAGGAACCTACTGCAGTTGCCTACAATTGCTACCTCTGAGGGACTTGCCTCTGGCC
CCTTGTAGACATTTCCATGTCTACACATGGCCCAGAGTACTTTCAGGGATAGCAATGTGT
GAATGGCACTTAGAAGATAACATGTGAAAGCCATAAGAGGGCATCTGGTCTATAGATGAT
TCTTTTTCCCATTAAGTCCATTGGTCCCACATCAAAGGAATGGGTGACCCCTCAGACTGC
ATTGCTTCCCTGTGCAGAGTAGAACCAGTGGCTGCTGCTTTGGAACCTTGAAGAATCCAT
GAAAAGTTCCTTCTCTTAACCTGGTTTTGTCCCTAGCACCTGTATTAGGCCCACATCTGT
AACTCTTGCTCCAGGATATCAGATGCCTCTGCAGGCGCCAGAATTCATATACAGCTCCCC
TTCACCCACGTGCATAATTAAGTTTTGTTTTGGGGAGTTTGTGAAGATACCTGGTGTGAG
ACTAAGCCCAGCCCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 2103..2282, 2370..2499, 2706..2815, 2908..3036
1039..1056, 2103..2282, 2370..2499, 2706..2815, 2908..2997
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved