Mus_musculus Locus D8Ertd457e
snOPY snoRNA Orthological Gene Database
Mus_musculus D8Ertd457e
Mus_musculus
D8Ertd457e
8
SNORA3
7419..7548
13955
CCTCAAAAATTGAAAACAAGTTGGGCAGTGGTGGCACTCATTTTTTTTTTTGTTTGTTT
GATTTTTTTTGTTTTTCTAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCA
CTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTACCTCCCGAGTGCT
GGGATTAAAGGCGTGCACCACCATGCCTAGCGGCACTCACCTTTAATCCCAGCACTTGGG
ATCAAGAAGTGTGCTTGCTGACTCTTAGACAGTGACTGTTGGTGCAAACGGTCATGGATT
CCCAAAAGTGGGTTAGGAATGCTTGTGGTGGCTCGTGCCTTTGAGCCCAGCACCTGAAAG
GAGGCAGAGACAGGTGGATATCAGGGCTACATAGGGAGAGACGGTCTTAAAAAAAAACAA
AGTCACTAATGTGTTATGTGTCAGACAGCGTGGGATGCTTAAATAAGGTGGCCCTGGGTT
CATTTCTATCATCATTCAAGTCCAAAATGCAAGGAATCAAACCACTACCACCACCAATAA
CAACAAAAAGGCAAAAGCTTAAGAAATTACATAGGTGTATAAAGTAAGGTAAACTAGGTC
CTCACAATCTTTCAAAGCAAACAGACTAATACTAAAACTAAAAGTGAATACATTTCAATT
GCAATTGAAGCCAATTTTTAGAGTTTTGTGTTTGGAGACATGAAACCTGTTTACTGCCTT
CGAAAAGCTTTGTATTTGCCTTGTATTTCTAGTTTAGACAGTATGTCTTATTGGAATGAA
TGAATGAACGCATCCTTATTAGGAAGGAACAAATCAAAAGACAAAAATAATCAAAACGAA
CCTACCAAACAAACAAACAAACAAAAAACCCAAACAATCAAAAGAGGGGTTAAGCAAAGA
GACAGAAGCCCAGGCCTGGGGCTGGGCCCTTGCTTCCTCCGGCACAGCCCAGCTGGGAAC
CTTAGGGGCCGGGGGAAGGGGGCGACCCGGAGGCACGCGACGGCACTTCCGGTGCGAGCG
CGCGGTACTTCCCGGCTGGTCCTGCGTCCAGCCGCCATTCCCGAGGCCGCACAGCCAGCC
CAGAGTTTCCTGTGGGCGTTTCCTCCTCTTCACTTCAGGACGCCTCGCCGGATGGTGAGG
AGCGGGCGGGCGGGCGCCTCGGTACGGGCTGCAGGGTTCGGCGGGAGGGCGGGCGCCGTG
GTGCGCTTGGCGCGGCCTGGAGGCCGGAGCGCCCGGTGGCCTCATCCTTGCTCTCCGCCT
CCGGGGCCAGCCTTGTGTTTTTCTTGCGTGGCGGCGCACAGGATGGGAGGGGGCGGTATC
GGTCTGGAATCTGCTTTAGGGCTGCTGTCCCGAGGCTCCGAAGGTCTCTGGACGTGGACC
GTATCCGGGCTTAGCCTCGCCCAGGTACCCTTTCGGATGGATGGCTGCAGCCTAGCGGGG
TGTTTTCCCGAGAAAGGGCCAGCGCTTTGGCACTTGACTGTGGAGTGTAAACCGGTGCCA
ATCTAGTATTCCCAAACATTTAATTAATCTAAAGATCGCTCGGTGCCCAGAAGTTCTACC
CCCAGGTCAACGGATCTTGCTTGTCAAGAACACAAGGAACTCAGAGCCATTAGCTACACT
GTTAGTGGCACACACGTGGCCATGCACTGTCTCTCCTGTAAACTGTGGATCTCCTAAATT
AGGCTGACGCTGCGGCTCGATGGTGAGCCCGTGCTTAGCAAGAGTGAGGCCTTGGGTTCC
ATCCCAGGACTTGGGAACAAAAAAGTGACACTTGTTACAAATTAGCTCACTGATCAACAC
AAGTTGTTAATGGAATTGGAAAACGTGTAGAAACGTAAGGGTTATTTGTGCTTTGTGTTG
TTGTTGTTGTAGTTTTTAAAGAAAAACAACCAGTCAAAAATGTATAACCTTAAAAAAAAA
GGCTATTCATAAAGAACAGTCTTATGGGCTGGAGAGATGGTGGCTCAGTGGTTGGGAGCA
CTGACTGCTCTTCCAAAGGCCCTGAGTTCAGATCCCAGTGACCACGTGGTGGCTCACAAC
CATTTGTAAGACAGCTACAGTGTACTTATATATAATAAAATAATAATAAGAAAAAACAGT
CTTGGGCTGGAGAGATCACTCAATGGTTAAGAGGTCTGACTGCTCTTCCAAAGGTCCTGA
GTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGATGCCCT
CTTCTGGGGTGTCTGAAGACAGCTACAGTGTACTTATGTATAATAATGAATCTTTTTTTA
AAAAAAGAAAGAACAGTCTTATTAGTATATACGTAGACTAATAGTGCCAACATCCTAGGT
TGCTTTCTGTTGCTGTGATCAAAAAACACCTGTGGGGAGGAAAGGATCAATCTCATCTTA
CAGGTTATAGTCCATTGTTGAGGGAATTAAGGGCAGGAACTCAAGCAGAAAACACAGAGT
AGAGCTGTGTTCTAGCTTGTTCCCAAACTCACAATTCAGTTCCCTTTCTTATACAGCAAA
GGCCTACACACCTAGGGACAGTACCTGCTACCGTGGGCTGTGCTTCCCACATCAATCATA
AATCAAGAAAATGCTCCACAGATGCCTATTAAATCACTATGATGGAGACAGTTCTTCAGG
TGAGGTTCCTGTATCCCAGGTGTGTTAAGTTGGCAACTAGTGTAGCTTACATATCCACTA
AGCTCACACATGTTCTGTGTTGGAGTTTTAACATAAAACATATATCAAAGTGTATTTTTA
AGGGACTATCAAGACCAGGTATGGTGACTCGATGCCTTTCGTCCAAGAACTCGGGAGGCA
GGGGAAAGTGGTGCTCTGTGAGTTGGAGGCCAGCCTGGTCTACATGATGAGTTCCAGGAC
AGCTAGGACGGCCTAGAGACCCTGTGTCAAGAAACAAAGCAGGACTGTCCATAACTAGTA
TTAGGTCTCCAGGAAGAAAGTGGGAGGGAGTAGGTGCGGATGCCAGAGTGCACCAGGGAC
CAGCGCGCAGACTTTTAGAGTCTTTTTACAGTTAGTGTTAGAAGTGCTGGAATCCACACT
GGAGTCTAGGCACATTGTTCAGCAAAGACTCAAGAGTCAAGCCCTTGAAGAATTACTTTC
AAGAAAGGGCATGGACTTGGGTTGGTGGGAAGGATCTGGGAAGAGTGAGGGATAGGAAGT
GATCAGACTATACTGTATGAAAACTATTTTTTTTAATTGAAAAGAAAAACCTCAAAAATG
CTTATAAAATTTGAAAAGAAGAGTTACTCTGAGCATTTTTCTCTATTGTAAAACAAAGAG
GTTGAGCTCTTAGTCCTTCTGGTCTTGTATTGATTGCTAGCTTCTCAGTGTGTGGTACTG
CTGACAAACACTTTGTTCCAATTCATGATAAAGCATTTTATAAAATGTTCTGGGGCTGGA
GAGCTGGCTCAGCCGCTAAGAGATCTTTTTGTTGCTGTAGAGAACCCAGGTTTAATTCTC
ACCACCTACTTGGTGGCTCACAATCGTCTGTAGCCTCAGTTGAAGGAATCCAATGCCCTC
TTCTGACCTTCATGAGCACCAGGCACACACTGTGCACAGACATAAATGTGTTCAAAATAC
TCACACATAAATAAATCTAAAAAAGTAAGACTTTTCTGTATTACCCATAGTTTCCCTTTG
TGACATATTGATATTCATAAGTGATAATGTTTAAATACTGCTTGTCAACATGGTGTGCTT
TACGTATTTTCCCAGCTTGCTCCGATACCCTGCCTCCATTCTTTCTATTGCTAATAATTG
AGTCAGGCCCTTGGCCTTACCCATGCCAGGCAAGTGCAATTCCATTAAACTACACCTCTT
ACAAAGACCCTTAAAAGTATTTTTATCTACTGGGTGGTGGTGGCGGCATATGCTTTGGGA
GGCAGAGACAGGCAGATCTCTGAGTTCAAGGCCAGCCTGGTGTACAGAGAGAGTTCCAGG
ATATTTAGGGCTACATGGAGAAGCACTATCTTAAAAAAACAAAAAACAAAAAAAAAAAAA
AAAGAATTAAAAAAAAAAGTTTAATAGTAAGATAGCTGTAATGGATTACTTGACATGGTG
GTACACACCTGTAATCTCCCCTTGGCAGAATGAGGTGGGCGATCTACCTGCAAGTTTGTT
TGTTTGTTTTTCATTTATTTATTATTTATTCACTTTCATCTCAGTAGCAGCACACACTCA
ACAGAGCATTCTTGGAAACTGTAGGGCTGCCCTACAGTTGATGCAGTTGATGTGTGGATT
ACAGATGCTCGCTAGGGGTCCTCAGCTGATTGTGCTGGCTTTCCTCTGCTGTGTCTGCGT
CTGTCCTTTGCCAGGCTCTGCTTTTTTGCCTGATGTTAAGCAGATCCTGTTAGGGCTGAG
TTTTCTCAGCTGGGGTTTTTGGTGCTTTATTTCTGAGACAGCTTTTCTGTGTCCCAGGCC
TGGAACACAGTGTGCAGCTGAGGATGACCTTGGGCTTCTCACCCCCTTTCCAGCTCTTGA
TGTCTTGACACGAGCACACAGGTCTCCTTTGCTTATAAAGTCTGCGTCGTCACAGAGCAA
TCTGAGGACTGATCAAGTACTTTCTGAGCACACAGTGCCAGGGACAGGAAAGGGCTACAG
GGGTGAACCTGGCTCTATGAGAGCTGAGCTGTCTGGGGTAACTAGGATGCTGACTATGCA
TCTGACTAGGTTTGAGGGAATTGAAAGGAAGGACTGCCTGTGCTTTAGGGTGACCCCTCT
AAAGGGTGGATGGGTTGCCTGTTGGGTAACAAAATGGACTGTACAGAGGAAAAAAACCAC
CTTTCTTTAGTTCCATCTCTTGAGAACCAGAAGAAGGGAGAGTCCCATGAGTTCAAGGCC
AGCCTGGTCTACATGGCAAGCTCCAGGACAGTCCTGGGTACCTAGTGAGACAAAACAGCA
ATACTAGTAATAATGTATTATATAATATATAATATATTTAATATATAAGTCCTAATAAAA
TAGGACTTACAGAATTTAAAATGTTATTCTTGTGTTCACTGATTTTGAAATAAGGGTGAT
CCTGTAATTTTTAGAAGCTGCAATCTGTGCTGCTCACTGAGGGCTCAGAAAGAATGTGAG
TATGGTTGCACCATTGCCTCCATCATACATGTGTTCAGCAGTGGCCAGTACTTTTGCTAA
ATTGTCCCAGACAAACCTCACTTGGGTTCTCGATCCACGGGCAAAAGGGTTCCGGTTACA
GGTGGGCAAAGAAGTCAGGGAAAGTGGAGTGACAAACAGACTCGACACAAGGGAGTGTGG
ATCTGAATGTAATTTGTCAAAATGAGCATCATACTTTTTTTTTTTAAGATTTATTTATTA
TTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTTGT
TACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTCGGAAGA
GCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCGAGCATCATACTTTTTAAT
ACAGATGAAAATAGGGAAGTTAGGTGACACGCTGGCAAGGTACAATGAGGTTACTGGATT
CTTACACAAAACAGGAATTCAAACATGGAAGGACTGGCAGGAACCAACTGGGATAAAATT
CAATGTTAACAACTGGGATCAAAAACAGCTCTACCTAAGGTCCACTTAATCTTAGAAGCC
AGGGGCAAGGGCCCTTGCCATAGCTCCTACTCTAGTCTATTGTATAGTCCACCTTCCCCC
TAGGCCATTGTAAATACTGTGTATGGGTATAACTCAGCTATCTATAGTTCTAAGTATCTA
CTCTGGTTCCTCTTTAGGTCACAAACTTCCTTCTTCCTAGATAATGGTAAATTTCTGTGT
AGGGCAGTGACTTAGCTATCCATGCCCAAGGTCGGATCAAGGACTGCCTAGAATCTAACT
TAGCTATATGTCAAATAGAGGCACTTATAATAAAGCAATATTAAGGGAAAGCACACAGAT
CCGTTTACCAACTAAAGCAAGGACATTGGAGTATTCGTTATACAGGATGCCACAATTCCA
GGAGACTAAGTTTCCGTGAACTTTTTTGCCTCGGGACAGTGCCCAGGTTTTCGGGGACCT
GTTGTGCTTGTCACTACTGGAATGGATGTAGCACTAAGTAGTAGAGTTATCCTTTAATGG
GAAGTAAGATTTATTTTTAGAGACACAGTCTTACTGTGTTTCTCAGGCTAGTCTCAACAC
TCACTCTTAGGTTCAAGTGAGCCTCTTGCTCTTAGCTTCCTGAATGGCCAGCCCTGCCAG
TCTGCAGGCATATATCACTTCCCTTGACAGTGAAGAGAAGATTTTGCAATGACTGAGTTT
ACTGTGTGTAATGGCTACAGTTTTATCAGTTACTGGTTCCTGTGTGGAGGAGCTAGCATG
CCAGAGTGGGCAGTGAAAGTGGTGAGAAATAGGGAGAGAAAAACCAGAGTTCAGAATAAA
CATAAAACTTAGTAAATATTAAACGCAACATTGCATAGTAAGCAAAGAAAGGGGGTTTGT
TTGTTTTTGTTTGGTTTTTCGAGACAGAGTTTCTATGTATAGCCCTGGCTGTCCTGGAAC
TCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGT
GCAGGGTTAAAAGTGTGTGTCACTACTCCTGACAGAAAGGGGTTTTCTAGTCTAGGGTTG
AAACCGCTGATTTTGGGTAAAAAGGACAGGCTAGATTTCTCTGTCCTTCTAAAGGTAGAT
TAAAGATGCAAATTTACTGTTGCTAAGGATGGAGCTTAGGGCTGAGCATCTACCAGCACT
TGCAAGGCGCTGCATTCAACTCACAGCACTGCCAAAACTAAGCTACAGCGTGGATTGGGG
AAATCTCAGAAACCCAACTCCCAGATGAAGAGTTCTAGACAGGCGCTGAGAGAGAATCAG
CTTTCCTGGGGATTAACCCCCTAATTGCTTATCCACGATGGAGCGGCTAGCCCTAAAAAC
ATACATACAAGGAACACTAAATGAGCTCCACAGGTATGGGGAAGGGGGAGAGAAGAGTAA
TAATTAAAGAAAAAGTCATGAATTTGGTGGGGGCCTGACACAGGATTATGTCCATATCTA
TGAAAGTTTTATGGTAAGTTTTTTTTAAAAAAATTAAAAATTGAAAGTAAACTAAAATGA
AAAACAACAAACCAAAGGATGGGAGTGTTAGAAAGTATGATATGACCAACATTAGAAAAA
CATACTAAATGATTAAAAAATAGCGGGGTAAGAAGGCATGTGAGGTGCTGTGCTTGTAAT
CCTAGCATATGGGAGGCCCAGGCAGGTGAATCAAGAGTTTGGGAAGCAGGCCAAACTGCT
ACATAATGAGACCCTGGGCTCACAAAAAGCATCACTTAGTCCGAGGCTAGAGTCACGCTC
TGGTATTGCTTGTTGCCTTAGTGTGCTAGAGTCCTCGAAGAATAACTGCTGACCTTATTC
ACTGGCTGTGGACTTTCTGGCACAGTCAGTCACCAGGTTAGTGACATCCGACATATGTCA
GGTTAACCCATTCAAAGTTACGTTGGCTTTTGTCAGCCCTATTTCTTTAGGGAACCCTTT
AAAGAGAGGGGGTGCTAGTTAGTGACCTGACTTCTGCTTTGAAAATTATATCTGGTGCCT
GCTGTGTCAGTGTTCCCAAGAGTGAACATTTACACTCACTAGTAGACGACTACAAAGATA
AGCTTACTCGGAGTGAGGCTCTGAAGATGGTTGGGGAAAAAAGCATCACTTAGAAACCCA
GATTCTAAGCCTTATGTTTTAAATTTTGTATGTAAACCAGTGTGTGTTTTATAAAAACCA
TTTGTGGTTAGATACTATAAAGTTAATGAGATAAATAATAAGCTGGAAAATATTTTAGAT
AAGGACTGTTCTCTTTGTAATTATATATTAAAGTTTACAACTAAGAAAGGTAGATATAGA
AAATGAACCAATACCTAATTTTTAAAAAGACAAAAGGCTAGTAGGGAAATTGTTCAGTCT
TTCTCATGAAAGAACAACACAGTAAAGCTGGGTATGGTGCTGTACGCACCTTGGGCTGCA
TGGTAAGGAGCAGGTTAACTGTGCTACCTATCAAAAGCCTGCCTTTCAAAAAAAATAAAC
GAACTCATAGGATAAAAGGAAACACCGTTAAACAGCAGGAGTGAGAGTCTTCCCGTGTAG
CAAGGAGTTTTACTCAGTTTTGAGGAGTTGGGGGAATCTTTCTCACCTGTACTCATGGTA
TATTTTAAAATCCAAACAGCCTTTGAGCCAAGTAGTAATTTACTATTTTCTATAGAAATA
CTCTCATATAAAAAAGTAGAAGGGAGTTTTATGCTTACTCTCTATAGCACGTGGGCATAG
GTTGAATGTGAGCCATATGTGTAAAATGCTCTGTGCTTGTATATGGCCAGAACAGTTAGT
TCCTCAGTAACACTGGTTACAATGAAAAAAAAAAAAAAAAAAAAAACTTGCTAAAAATGT
ATCCTCCATGCCTGATGTCTGTGAGACACCCTGAAGAGCTGTAGGCTCAGAAAGGCCCTT
TTGACAGCTTCTCTGTTTTTATTCTAAGAGTGGTTAAAATATTCCAAAAGTTGATAGAAA
ATAAGGCCAGGATCATGTTGCAATCTTTCCATAGCTAGACTTAATAATTTCCTGGAAAGG
ATCTAAAGTTTCTTCCTAGATTTAAGTCACCTAGATATGCATCAGCTCTGTGTGTGGACA
GCTTGTTGATTGAAGATCTTAGGGCCTAAGTGTAAGGCTACAGTAAGTAGTGGGAGTTGA
TTCTTGAGAAACTGATAGTCCTGGCCCTGGGCTAGAGCGAGTCAGTCAGTGTCTGGGAAG
GTACGGCTATGTCTTCCCGCAGGAATGAAGAGGGTGTGCTTGAGCGACAGCCTTAGAGTT
ACCTGAGAGGCCCCAAATAAAACTCCAAGTGCTGTGCTCAGCCAGAGTTAGTCTCCCTTT
TCTCAGAAATCTTGTAGACATTTTTAGTAAAGCATATGCCATTCCGGGCTCACAACTATG
CAAGTACAGTATTGTGTTCAGCACAGAGTCCTTTGGAAATAACTTCTTTCTCTGTTGCAG
CACTGTTGAAGTCTTTCAAGTGCAGTTCTACGGCGTGTGACAGAAGATGGAAGTGTGTCA
GGAATTGAGGAAACCAGCGCTAAGCCTGGAGTGTGGGCACTGCAGTTTCAGAGGCACCGA
TTATGAGAATGTGCAGCTCCACATGGGCTCCATTCATCCTGAGTTCTGTGATGATATGGA
TGCCGGGGGCCTGGGCAAGCTCATCTTTTACCAGAAGAGTGCAAAGCTCTTCCATTGCCA
TAAGTGCTTCTTCACCAGCAAGCTGTACGCCAATGTGTACTATCACATCACGGCCAGACA
CGCAGCCTCGGACAAGTGGAGTGAGCAGCCGAAAGAGCAGCCGAGCAAAGACACCGAGTC
TGGGAAAAGCCCTTCCCCTCCTGAGCGGCAGAACCCAGCCTTTGACCCAGCAGAGGCGAG
GCCCACTCCAGCCCTCCCCATGGAAGCACAGAAAACGAGCCCGAGCTTGTGTCCAGAGTC
ACAGGCTTCTGGTCCTCCAGTTCTGGAGCCTCAGGGCGCTGGTCCTCTTATTTCGCCCGA
GCCCCAAGCCCCTTGTCTTCCTGCTGAGGCCTCAAAAGCTGCTCCTGTTCCTTGCCCTGA
GCGTGTAGACCCACCCTGTGAGCTTCCTGAGCTGGAGAAGCCTGAGCGAGGCCCTTCTCC
TGAGTCAGTCAAGTCTGCTCTTGTCAGCTCCAAACCCCCAAAGCACTCTTCCTTTGCAGA
CACAGGGGCTGCCCCTTCAGCTTTGTCTCCAGAGTCACCAGTACTGGCCACTTCCCCTGA
ACCTTGGGGACCATCCCTCAGTGCATCTCCAGAGTCTCGGAAGCCAGCGAGGACTGCCTC
CCCTGAGCCAAGGAAGCCATCCCCAGCAGAGTCTCCTGAACTTTGGAAGCCATTCCCTGC
CATCGCTTCAGAGCCTCGGAGACCAACCCCAGCAGTGTCGCCAGGTTCCTGGAAGCCAGG
GCCGCCTGGTTCTCCTAGGCCTTGGAAATCCAGTCCTTCAGCAACATCAGGACCGTGGAA
GTCATCTAAACCTGTTCAACCTATGTCTCCTGGACCTTGGAAACCAATACCTTCTGTATC
ACCTGGGCCTTGGAAACCTGCCCCATCTATGTCCACTGCATCCTGGAAGTCTTCAGTCTC
ATCTGGTTCCTGGAAAACACCACCCACATCTCCAGAGTCATGGAAGTCTGGCCCACCTGA
ACTCCGGAAGACAGCCCTTCCCTTGTCTCCTGAGCACTGGAAGGCAGTGCCTCCCGTGTC
TCCTGAGCTCCGCAGACCAGGCCCACCACTTTCCCCAGAGATCCGAAGTCCAGCAGGTTC
TCCAGAGCTCAAGAAGCCTTCAAGCTCACCAGACCTTTGGAAGGTTTCTCCTGACCAGCG
GAAAACTTCTCCTGCTTCACTTGATTTCCCTGAGCCCCAGAAAAGTTCTTGTGGTAGTCC
TCCTGATCTCTGGAAGTCTTCCTTCATTATGGAGTCTCAGAAACCTAACGTCTTCTCTGA
GACGAGGAAGCACACTGCTTCGGGCTCATCTGAGTCACCGAAGGTAGCGTCAGACATATG
GAAGCCTGTCTTGTCTATCGATGCTGAGCCTAGGAAGTCCACACTGTTTCCTGAGCCCAC
CAAAGCAGTCCTTCCTGCTTCTCCCGAGCCACGGAAACGCGCACTTTTCCCAGAGTCCCG
GAAGCACGTGTTTCTACCTGAACTTCCCAAATCCGCTGTGTTCTCAGACGCCCAGAAGGC
CCCTGAGCTTAGTGAGGAGATACAACTTGAAGCTGTGGATAATGCAAAATGCGATAGTCT
GGCCCAGGAAGGGCTTCTGGCCACCCCCAAGAAACTGTTAGACGAGGCTTTATCTCCTTC
TTCAAAGAAGCTCAAGAAGGACAGCCAGGAGAACTCGGATGCCGAGCTCAGTAGCAGTGA
ATACATCAGAGCAGATTTAGACACGTTGGACACGAAGGGCCAGGAGTCAAGCAGCGATCA
GGAACAGGTGGATGTGGAATCGATTGATTTTAGCAAAGAGAACAAAATGGAGATGGGTAG
TACAGAGCAAGCCAAAAATGTGCTTCAGTTCACCGAGGAGAAGGAGGCCTTCATCTCTGA
GGAGGAGATCGCAAAGTACATGAAGCGTGGGAAAGGGAAATACTACTGCAAAATCTGTTG
CTGTCGGGCCATGAAAAAGGGCGCTGTCTTGCACCACTTGGTTAATAAGCACAATGTCCA
CAGTCCATATAAGTGCACAATTTGTGGAAAAGCGTTTCTTTTGGAGTCTCTTCTTAAAAA
CCACGTAGCAGCCCACGGGCAGAGTTTACTTAAATGTCCACGCTGTAATTTTGAATCAAA
TTTCCCAAGAGGCTTTAAGAAACACTTAACTCACTGTCAGAGCCGGCATAATGAAGAGGT
GAATAAGAAGCTGATGGAAGCCCTGGAGTCGCCATTGGAGGAGCAGCAGATTTGATCTTC
AGACAGTGGCCCTTGCTCTACAGTGTTGCTTGCCAGACTCTTAGGTTGTTGAGTAGCCTA
GATGGACCAGTAGCCAGTATGTGTGTAGTGGTGTATCCTGGTCTGTAAGTAGTGTTACAA
AAAATAAGTACTTGGTTATTTTTTCATATGATCCGTTGTTTATGTGGATGGCTATTTTAT
AAGTCTTAATACATTTCTGTTATAGATTCCAGATGGATATAACTCATTTTCCTTAAGTTT
TATTTTTGTTATAATACAAGGAGTGGGGGAAAATAGGCAGGCCATTTAATAAACAAGTAA
GTTTAAACCTAATCAGAGTCTTTGTCCTCCACCATGTGTGTGTGTGTAACTGATTTCAGA
ACATAGAACTTATTAGATGAGGGCTCAGTGGTAGAGCCTCGACTAGCATGTTTTGCATAC
TTATCAGTTCCAGGGTTCTATCCCCAATACCTTTAAAAAAAAAAAGTGGAATGTATGAGA
ATTGAGCATGAAAAGTAAATTTGAGAAAAATTTTGTTAAATGTACTTTTGAAACATGTCT
TATATCTTATTTTTTCATGTAAAATTAGTTTATAAGTCTTTAATACTTTCATGATGATCA
TTAATGCTGTTACAGAGCGGCACTTCTCGCCCTGGGGGTAGAATGACCCTTTCACAGAAA
GCAGAGATATTACATAATGGTGATAGCAAAGTTAGTTATAAAGCAGCAATGAAAATGTGA
TGGTTGGAGGGGCCACCATTACATGAGGAACTGTATTGAAGGGTCACAGCGTTAGGAAAG
TCGAGAATGCTGTTGAAGAGAGTTGGAGTCTTAGAGCCGCTGGTTTTCTGCTGCTAGGAC
AACTGAGTGGGTTTGCAAAGCAGTGTTGGTATTTTCTGCAGGCTGAGAAGACCACATGAT
TAAGGCCACCGCTTCCCTCTAGTTGTTTGCAATGGCGTCTTCCTTGTGGGGTCTTGCCCT
TCACGTCCCTGCCTGATCACATCAACAGATGGTCTTCACTTGCCAAACGTGTTAGTGTCT
GTACCTCCTACCCTGGGTCTTATGTGCTTTCTGTCGGGTGGGGCTTGAGACCCAAGTAAT
GAGCAGGAGCTCAAAGTCTTCCAGATTGACAGTAAAAGGTTAATAAACAGCGCTGGTGCG
GCAGCCAGCGATCCACACTGGATGCCGACTTGGTTGGTTGGGAGCTGAATTGATGAGGGC
TCACTGTATCTCACCGTGGGCAGCACAGTGAAGCCCTGCCTCAAAAGCATTCCTGTCTGA
AAGACATGTCGCTTTGGTTTCACATGGTTTTGCCATTGTAAATACCTTGTATCTCTCTGT
GGATTATTCTAATAGTTTGTTAAATGTGTATCAACCAAATTAAAAAGGCTTTCACGATAA
CATCTTCATGTGTACTTAATTTTTATAATTGTATTATAATCAGACTTATGATGCCTGAGG
AAGATAGTTTAAAATAAGACTTATTTTAGTTTTGTAGGTTTCAATGGCTTGTAGGCATGT
GGCAAGGATTGGAAGGGTGTGGCAGAGAAACACTGCTGCCCTCAAGGTATCCAGAAGAAA
GAGAAGAGGAATGGAAAACGCCCAGGGCCAAGATATGTCCCTCACAGGCACACCACGAGT
GACCCACCTTGCCCAAGTGTGCCACCACTTCCCATTGGTGTATTCCGTTTTTACTGTAGA
GGCTGAAGCATTGTCCAGAGCAGAGCCTTCACAATGTACTCCCGAAAGTGCCCTCTGGCA
CATGGATGTGCTGCACTAATGTCTGTCCACTCAAGTCAAGATGAATTGCAGGGATTTTCA
GTGGCTTATACCCAAATGTCATCCTAAGAGACTAGTTTTCATGTGTTGAGCAGTCCATTC
TAAGCCACGTTTCCCCTTAGTTCTGTAAGGTGGTTTGATTTCAGCGGGTTGCCAGTCTCA
GCTACAACTGAGACACAGATTTAGCTCTTTGGGTTTGGCGCCTACACCCTGTTCTGTTTT
AAAGTGTGAGATTTAAGCCGTTGTTCTTGCCCCGTCCACTCTGGTTTTAGACCTTGTATG
TATTAAGAACAACTAACTAATGTGATGGAACGACTTTGCCTCCTGTACAGCTGCCACTTA
ATAATATGACCGGCTTAGCGCACCTTTATTTTCTTCCTCTGTAAGACTGGTTGTAATGCG
TCTCAACTCAGTGTTTTCATGGACTACAACGGGAAGAAAACAGTGGTAGCCACATCTGTG
GGGTGGAGTCTGTGACATCCTTGGATACTAACATACCTGAAAAAGCATCCTAACAGGGTC
TTGTCCCCCAAGAAAGTTCTTTTCCCAAGCTCTGGCCCCATTCCCTCCTGGGCTTGAAGA
AAGTTCCTGCTTGCTAAAAGTGGAGTCATTCTCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 9120..12955
9166..11571
AK129444.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved