Mus_musculus Locus Cep55
snOPY snoRNA Orthological Gene Database
Mus_musculus Cep55
Mus_musculus
Cep55
19
SNORA42
17890..18014
21382
TGCTTTGCTACTGATTTTTTTCGCTGTAAACTTCTGGTATGCCTAGGCTAAGTCTAAGA
ACGACACGCCATAAGCAATTGTTTGCTTCAAGTTCTCAAGACGCTAATCAAGACCCTGAT
GTGACCGATAAAGACCAATAAAGACACATCTGCCTGTAGGGCAGCAATCTGGAATCGCTG
CTGGGGCTCACAATCTCGGTTTTCAAACTGGGAGTTTATCAGCTCCCTACAGCTTCGTTC
CCCATTGCTCCGCCCCTGAGTTTGACAGGGTAAATGAGTGGCCCGCCCGGAAGACTAGGA
GGTTGTGCTCTACCTCACAAAGAGAAATTGGTTCCCAAAGAACATAGACCAGTCAGTCCC
AGGCGAGGGTCACAGAGCTTGTCCTATGGATAACAGCAGGGTCCGAACACACAGAGAAAA
GCAAGCAGGCCCAGATTGAACTGGTCCTCCGACTCTGTCCTTGGCTCCGCCTCCACCACG
CCCACACTCCCGCACACCCACACCCACACCCACACCATCACACCCGCCTCATTTCACACC
ACGTTTCCACAGACACCCTCTATCTTCACAAGGTCCTTCTCTGACCCGGCCGGCACGGAT
TGTAGCTCCCGTCAGGCTCTATGTCTTGCTCGCCCTTACCTTCCCCACTCTGCCCCTACC
CGTCTGCCCGGCTAGTTTCGATCCCCTCCCTCTGATTCCAGAGCCGGTCTTCGCCCCGCC
TGCCGTCGGGTTCCAGACCTTGCCCCGCCCCTCCTCTGGCTCTAGACTCCGCCTTTGCCC
CGCCCTCAGGCTCCTGGGCCCTCCCTCTCTCCTCCATCCTCAGATTCCAGCCTTCACTCA
GATTGCAGGCCCCGCCCTCTCCCGCCTTTCCTCAGATTGCAGACCCCGCCCTCTCCCGCC
CGTCCTCTGATTGCAGACCCCGCCCTTCGCCAAGCCGGCAGTGACGTGACCCGCCCTACA
GCCGCGGGATTCAAACTCCCGGAAGCGGTGTCCTGGTTGATAAGTGGTCTGCGGCGGCGA
CGCGAGCGCTGTGTTTGTCTCAGGTAGTGAGTGGTCCCGGCCTCGGCCGGGGAGGGAGGG
GAGGACAGCCGGGGCTCGTTAGCCCCTGGGCAGGACTAGACCTCCCGGGAGGAGCGCTGG
TGAGCAGATCACGCCGCAGGACTCCGTCTCCCCTGGCTGGAATCGCTGGAACACATGCTG
GCTCCCTGAGAGACCCCGCGCTGCGTTCCTGTCGACCGCCGGCCCGCAGGCCATCCTTTC
GGCTCCTTTGAACTTGGCGGTATTATCACTTTCTTAACAGAGAGGTTACCGCGAGGCCAG
TGACCTGAGCCAGGTCTCTCAGGTCTCCAGTGCGGTCAGCCTTTGCTTAGCAAGCGCTTC
TCTTTGCAGTTTTTTATTTTCCTGCCTCTTTCCTGACCCCTCGTAGATTTGGGAGATTTA
CTGAACGGAAATGCTTCTTTAGACTCCTGACCAGAATGACTTAGGTCCCTTCAGTCGAGT
CAGAGATTTCCAAGCAGCTGCCTTTAAGCTCTTGTATGCCCCCCCCCCCAAAAAAAAATC
AAAACACAGTTCTTTTGAACAGTTGTTGATTGAAAAAGAAAATGTTGTGAGCAGATAGTA
CTGACTGCTAGCTTGTGTATGTATGGTGAGTTCTGTGTCCCATATTAAATTTAAGAGAGC
ACATCCTGAAGGAGATTCCACTAGGACTGGGTAGGGACGTTCCCGAGTAGAAGAACTTTA
AAAAAAAAAAAAAAAGAACTTTATGATCGATTGGAATAGAAAATACTGGGAAAGGAAAGA
CTAGGTGAGAGCAGGATTGAGATGAGGAGGAGTGTGTGCTGGGTCAGCCTAGACAAGAGT
CAAGAACACTAAGTTTTTAGGAATCCTCTCCAAAAGTTAGGATGCAAATGTCCTGAGGGT
ATTTTCAAACTGTTAAGTCCTCCTTCTGACGTCAGCAGAAGCCCAGGGAGAAACGTTTGT
GGTAGCAGGTTCCTAAAACACGTTAACTGTGCATTTGCCTCGGCAGATTGTACTAGCAAT
TTTACTTGGTATTTGTCAAGATAGTGGGCAAAACCAGGTTGAATGCATTAATACAGATTT
CGTTCAAGTTTGTTTATGCAGTTCTATTATTTTTAGGCTGATTTTATACAGGACAACCTC
ACACTCACCGCCCTAAGTAGATTTTCTTGTAGTGGTAGCTTTTATGACTATTAGTATTAA
TTACAGTTTAAGAATATGTGAATCTCCTTTTCTTTTGTTGTATTGCTGTTGCCTGCTACA
CTGTTCTGAAAGCTTCCTAGCATCCGAGACTCTATGTTGTTTCTTCTTCTTTCTGTTGCT
TTAGCCAGCTTATATCCAGTCCCGATTAGGTTACCTGGTAAAAAGGCTTTGTAGTAATAG
TCTGTGATTTGTTTAAACAGTTTTGTGCAGCTAGGCTGCCTTCAGTCTATGCAAATGAGG
CTGGCCGTGAACTCCTGCCCATCCTGCCTCTACTTCCTGAGTGCTAGGATTATTAGCCTG
TATCACCATAGCTTTGTAGTAACAGTTGAATGAAGGAAGGTCTTATCTTCCTTTCAATTC
CATGATCACCTTGCCTTCATTTTTATCTCAGGACATATGAGAAAAATGGTTTTATTAAAT
CTCTTAATGGAGAGCTATTTTTTACATTATTTATATATACAGTGTATTTTACTACACATC
TGCCTGCCTAGAGTTTGTATTCTACATTTGCTTCTAAACTCTCATCTAGTACTATTAGCA
GATGTGAAACTTGGCCTAACTTCATTTGCCCATTCATTTCTTTCACCCCCCCCCAATCTC
TGAGAATTACACCTCTTTTTCTATAAATGTCTTGTGTTGGATTTTCTCACTTCTTCCTGC
CATACGCTCTAAAACGAATAAGATAGAGTTCTGTAGCCTCCCCCAGCCTTGAAGCAGGCT
GATTCAGACTTTGCTGCCACTGAATATGAGGTCACCTGGGGTGTAGCCTTCGACTTAGAT
GGCTATATTATGTCAACTACAGATGCTCTTCTCTGAGACTCTGCTACCTGCTGAGAGAAC
CTTGAGACATCCCGGAGACACATCCTATCCTGCATGTCGCCTACTTGTCTTGGCTTCATC
ATTCTTTTCTCAAAGTCTAAGTCTCTTTCAGCCCCACCCTGCCTTCCAGAAATACCCGGT
TCATGTAGGCCTCGGGCGACTTACATCAGAGTTCAACTACACATACCTTCTAAAGCAGAG
AGCACACGTTGAGTTCATGACTATAAACTCAGAATTAGAGTTTTTATTCTTGAGTATGAT
ATCACCTTGAAAGTGGAAGGCCTGGGGACCCTTCCACTGATTGTAAACCAAAACTTTCTG
TTAATTTACAGGTGCCTGTAAACCTATAACCTGGGAGGCTGAAGCAGGAGGCCTGTGAGT
TCGGTGCCACCCAAGTTACGTAGTGAGTTCCAGACTCTCCTGGGCTGCCTTGAGAGATCT
GTTCGCAAATATCAGCAAAAACAAGTATGCAAATTATATTTCTAGAAGGTAGATATTTCC
CTTGTATCTACCACCTAAGAGTTTTAGATTCATAATAACACCCTAAAAAGCTTACTCAAT
TTTCTTTCCGGACCCCACTGATTTGGATAAATCACTTCTATTTAGAGCAGAGTACATTAT
AAGGCCTCTGCCAAGCCTGAGATATGAAAATTTAAACTCAGACTTCAAAAGCAGTTGAAT
TTTTAAAAATCATTTTTTGTATTTTCACAGATCATTGCAACGATGTCTTCAAGAAGTCCC
AAAGATTTAATTAAAAGCAAATGGGGATCAAGGCCTAGTAGCTCCAAGTCAGACACTGCA
TTAGAGAAATTTAAGGGAGAAATTGCAGCCTTTAAAACATCCCTGGATGAAATCACCTCT
GGGAAAGGAAAAATGGCCGAAAAAGGCAGAAGCAGACTCTTGGAGGTAAATGGTCCTTGA
ATCCTTTAAGGTGAATACACTCTAGAAAGCGGTGTGTGTGGCTTTCTGATGCTACAGTCT
TCTTCTTCCCGTTGCCCGCGCTTGACCTGATCTCTTTAGGTCTAGAAAGCCGATCTTGAA
TTTGGAATCTTAAATTCCTGCTTTGATTTTTCTGACCTTTAGACATACTTTAGTTCTTGC
TAAATCTCTCTTTTAAAATGCAATTGAGTATGTGTTTTGGGGTTACCAGGCATTAAGTTG
TTTCAGAAATAAAGACATGATTAATAGTTTTGTATCTTATATAATATAATGTGCTATGAT
CTGGTTTTTTTCCCCTCACTTTTAAAAGATTTATTTTTTGTGTATGAGTGTTTTGCCAAC
ATGTATGTGTGCACATCATATGCATGCCTGGCACCTGCAGAGGTCAGGAGAAGGCATAGG
GTCCCCTGGAACTGGAGTTTGGGTGATTATTAGCTACCATGTGGGTGCTGGGAATTAAAT
ACGATTCCTTTGCGAAAGCAACAAGTGCTCTTAACTACTGAACCAACAGTCCACTCCCAG
ACCCTCACATTTTTTGTTGTTTTTGTTTTGTTTTGCTCTTTCAGGTAGGGTCTCATGTAA
TACAGGTTGGTCTTGAACTTGAACTGAGGATGAGCCTAAATTTCTGATTCCCCTTGCACC
CACTTTTAAGTTCTATGATTATGTGTTGTAACATTTATTTCAACATTTCAAATATTGAAA
ACAAACCAATAAGCTTGGCATTCATCATGTAATTTTTTTGATAATTTATCTTTTAAAAAA
TATTTATTTACTTATTTTTATTTCATGTGTATTGGTGTTTTGCCTGCATGTATGCCCATG
TGAGGGTGTTGGTGTTTTGCCTGCATATATGCACATGTGAGGGTGTTGAGTCTCCTGGAA
CTACCATTACAGTTATGAGCTGCTGTGTGTGTGCTGAGAATTGAATTTATATCCTCTGGA
AGAACAGCTTGTGCTCTTAACCACTGAGCCATTCTCTCTAGCTCATTTATCTTAGTTATA
TTAATATTATTGATACAAATTTGTTATATAATATCAGTCTTTTGTATTGTTACAACACAG
TGCTATCTATGAGTAATTTGAGTAGGGAGAAAGAGAAATATTTAGCTGCTAAGTCCAAAA
GCAAAGTATGTCTGGTAAGGATCTTCAAGCTGTGTTATCACATAAGAGAAGGCCAGGCAA
GCATATGAGGTATATGGAGGACCAGGCCTGAATTCATTTTAACTGATAAGTGACCCCTGA
CAACCACATGAGTCTACTCAAGAGCTCTGTGCCCTCATGACCCCATCACCTCTAACACTG
TTGCATTGAAGGATCATATTCAAACCATAGCATGCTGTGTTTAAGATTGTAAAACATACT
AGCTTACTGCATGTATTGTCATTTTCATTGGCTCTATAACTTGGAAACGCTCTGTTTCCA
TGATTTGGGGGATGCCAGAAAGATACTGTGCCATTCTCTACCTACTTCCCTCCCCTTTAA
TATTTACTCAGCTGTTAACATGATTTGGTTTTTGTTTTTTGCTAGTTCACCAGATATATA
AAAACAAAAACAAAACAATCAAACTTATGCACTTAAAATCGCCAAATTGTTTATCCACTT
CAAAGTGTTAGTGTTAGGGTTCCTTCTAACTGTTCAGAATCCATCTTATCGTTCCTGTTG
GCTGCCCTGTTAGCCTTTCCTTACTGACAGTTGTTTTTATCATCTTTCTCTTGGTTCTTT
CCTGTTTCTCCACAGCTATGTGACAAGCATTGGTTTAGCCTCCTACCGCCATTGATCCAG
ATGTTTTTTCCTTTCTCTCTCTCTTTCTCTCTGTCTGTCTGTCTGTCTGTCTATTTGGTG
TGTATACATGTTAACTAGAACACAGATGGCGTTGATGAAAGGGCTTGTGTGTCTGTGAGC
TGTCTAAGCAGGGGACTGAGCTTCAGCTTGTATTTTCAGTCCTGATCTCGTAAAATCCAA
GTTGATATGTAATAAATACTTCTTAAACACTTGTTGCAATATACTGTTTAGCTGGATGTT
TGACCTGGCTTAGTTCTAAGATTCTTCTTAGTTCCTATCTAGAAAATCCAAGTTCTTGAA
GCCGAGAGAGAAAAGAATGTTTATTACCTCCTGGAGAAGGACAAAGAAATACAGAGACTC
AAAGACCACCTAAGGTCAAGATATAGCTCTTCTTCATTGTTCGAGCAGCTGGAAGAGAAA
ACAAAGGAATGTGAGAAGAAGCAGCAGTTGCTGGAGTCCCTATCCAAAGAGACAGATGTC
CTGAAAAACCAGCTGTCCGCCACGACGAAAAGACTTTCTGAACTTGAAAGCAAAGCCAGT
ACACTCCACCTGTCACAGGTGCTAAGCTTTCTTTAAACTGAGATCTTTGCCCGTCTGGTA
CAACTTATAATTCCTGTGAGGAGTGAGTTTTCTACGGTTTGTGAAATGATGCAACACCTT
AGTTAGTGCACCTGCAGATCACTTACCTTCTTATTGTTTGGTTTTGTTTTTAGTTGAGTC
CCTCTTCCATAAGTAAAAATAGTTCATTTGGTTCCCTGCACTCCCCACACAGTGTTCCTC
CCAGATGAATAGTCAGAAGACAGTCTGTGCTGTAGCTACAATAATCGAGATTTTGCTGAG
ATTTTATTTCAATAGTTTGCACTACATAAACGTTATGTTGACGTTTTTGATTCGTTTTCA
TATTTGAGATAAACAGTTATCCCAATGTGTTTTTTTCTAACTGCACATACATTTTTTTCT
TTCCCTCTTGTCTGAGAGGAACAATGTCTCAGGAAGTACAAGGATCTGTGTAAAAATCGT
CTGGGTTTAAATCTTGATTCTGCCACTTGATAGCATGTAACTCTGAGCAGACAAACCCCT
TGCTTCTCTGGCTGGAGTTTGTCAGTCTTCCTTTTATAAGCCTTGCCTTCATATCAGTAA
AGCTGGGCCAAGAGCACTGATGATTAATTATGATAATGATGGCAAGCTGCCTTGCAGAAA
GCTTGGAATATACTAAGTGCTTAGTTAATGATCAAACCTCCGGTTCTTTTGACATCTGAA
TATTACTAACAATTAGTAATAGTACCCATAGAAAAATAAGTTCAGTTGTGATTTCTCAGT
GGTGTGATGCGGTATGGGTTACTTTTCCTGTGGCTGTGTTAAAATACTCTGATGAGAGCA
GTTTAAGGGAGGAAGGGTTTGTTCTGGTTTCTAGTCCTTGGGGATCATTCCATCTTGGCT
GGGAAGGAGGCCTGGCAGCAAGAACAAGATGGTCACATTGCTCTGGCACTCAGCAACCAA
AGGGAGAACAAGTGAAGCCCTGCCTATAAAGCTTCAAGGCCTGACCCCAGTGACCCCCTT
CCTCCAGCAAGACTCCATCCCTACAGGTTCTGTAGACTTCCCAAACAACCCTAGTATCCA
CACAAGCCTTTCCTTACAGATACACCAAGATCACCCAACCCTGAAAAGTAGGCTTTTCAG
TTTGCTGGCTAGCCTGTGATGATAGCCACCTGGTTTTCTCTATGTGAGAATGAAGAAAGG
AAAGCCATTATGGAATTATTTTTTGAATTCTGTGAAAACTATACAAATAGTGTTACTATT
TAGTATTGTTATAGTCTCCCAAATCTGAAACTTTTCAAATGTTTACAAGTAGAAAAATTC
ACACCTGACCTCACATAGCTATCACAGCAAGAAACTGAACACATTAAACAATTTGTGGAC
AGGCTATGTGTATATGTGAAACAAATGGCCAAGTGGTGGTATTGCATGCCTTTAATCCCA
GTACTTGTGAGGCAGAGGCAGGCAGATCTCTGAGTTTGAAGCCAGCCTGGTCTACAGAGC
AAGTTCTAGGGAAACTAGGGCTATATAGAGAAACCCTGTCTTGGAAAAAAAAATGAATTT
CATATTTAGAGTTGAGTCTCATCCCAAATATATCTCATTATGTATCTAAATATTTCAAAC
TCCAAAAAAGTACAGTATGAAACATTTTGGTTCTGGTAAGTTTGGGAATCCTCAGCCTAT
GCTGATATAAAATGTAACTCTAGAAAACACTTTATGTCTTTGATAGTTTGGTTCGTTTAT
TTGAAATAGCCTAGTTTGACTTTTTTTGATGAAAACTCAGTGGGCTATTTGTAGGGGTTG
AAGGTTCTGGATATTGGGGGGTCTAGGAAATCACAGTAAAATTAGATCTGAAGTCTCGGG
GGGCGGGGGTCCTAGATTGCTTAGGACAGTGGTTTTCTACCTTTCAAATGCTGGGACTCT
TTAATACAGTCCTCAGGATGTGGTGACCCCAACCATAAAATTATTTCATTGCTACTTCAT
AACTCTAATGTTGCTACTGGTATGAATCATAATGAAAGTATTTTTGGAAATAGAGGATAA
CCAAGGGTGGTGCGACCCACAGGTTGAGAACTACTGGTATAGGAGACTATCCAGGGAATT
TAGTTCTGGTGGTAGTCCCCTGATAATTCTCACCTGGCTTGGTGGTTCACCAGTAGTAGA
GGTGTGGTTTCATTGTCTTGAGAAATGTTTTGTATTTTTATGGAAATATAATGAAATTTG
TATTGTTAAGTTGATGATGTCAGCTACTATTGGCTTATTTACAGAGCATGCCTGCAAACT
GCTTCAACTCCTCAATGAATAGTATTCATGAAAAGGAGATGCAGCTGAAAGATGTAAGTT
GTTTTGTTGTTGTTGGTGGTGGTGGTGGTGGTTAAACAATGGATAAAGAAGACAAACTCG
TATGTTCTTTAAATTTTATAGAATTGGAAGCATTAATGTTATGACTTTAAAAAAAAAAAA
AAAAAAAAACAAGTCTAATGAAGAGTCAGGAGAACTGAGTGTTTGAGACCATGGTGTAGA
AACTCTGTAGATTGCAACGCCCTGGAACTAAGCTTCCAGCTGCCTTAGCAGCATTCTTTT
CCACCTCAGTCTAACTCGCCCAAATTGTTGCTGTTATGGTGCAATTTAATTTATGCTTTT
CTTTTTGTTTATCTATTTGATATGTATTTATTGAGTGAAAAACAGAAATAAAAAGGAAAG
GAAGGGACATGCCTGCTCCTAGGTATGGTGGAGGAGAAAGTTTATTATAGGTAAAAGGGA
AAGCCAGAAGCAGGGGGACATCTGGGAGTCCAGAGTGGTCTTGACCCTGAGCCACGTGAG
GACAGATGGGGAGAGAGGGTAGCCAGGTACAGCATCCAGGAGGCCAAAGGTATTAAATGA
ATGAATGAATGAATGAATGAATAAATAAATAAATAAATAAATAAGGTGGGTAACCTATAA
TGTCTGGATTATATTGGGAAGAACCTCTTGGGGAAGGGCAGCCCAGCCCTGGATTTAAGT
GTTCAGGGTAGGGGTGGGGTTCGTCAGCCTTATTCTGTAACCTGTTTGGACTCTGGGGGA
ACCTGGAAGCCTGATCAGCTTTGATATGTTAAGTAGGCACCTGAGCTGTTTGTCTGGGAT
TTGAAACCTAACTTTCCTTATCTTCCAGTCTTTCTCCAAGAGTTGGGAAGGAAATGTGGT
CTATGTATGCGCAGTAGTTCTCCAGAATTAGACATGAGGTTACTTTAGATGGACCGGAAA
GCTTTGCTTTATTATTTCTAACTTTTATAAGTGGATAAGTAAGTTTTGTTGGAAATTGAA
TAAAATGAGGTCACAGGACTGTCTGCATCTTTTCAAGTTTTAGATGAAAATATATGAAGT
ATAAAGTTGTTGATATAATTATTAGATCACCAGGTAGCTGTTTATATTACAGAAACATGG
TGTGTTTACCTTGATGCCTGATAAGTCTACCCTTAAGATTTCTGTTTTATTTAATCTAGC
AAGTGTCTTTTGAAGTCTATTTGATTTTCAAAAGAAGAATTTAAATATCTTGAGTATCTA
TACAGGATGGTTTGGTACTTTTATCAAAGTATTTACCTGGAGGTAATTGAAATAAACATA
ATTTTAAAATATGTTACATATTTAAATATGCTAGACATAAGTTACAAAATAGAGTATTTC
GGTATCATCTTTTACAGAGAATTTTGTCCATCTGTGTATACTGGTACCTACCAATTAGAT
GCCTGTATTTAGGTCATTTACCTTACATGCCTTCCATTTTCTCCTCCTTTGCTTCAGTCT
TGCTGGATTTCCAACCATTCCTTAAAAGGAAAACCCTGGTTTCCTGGGTGGGCCCCTCTG
TTTACATAAGAAAAACTCTAGTGCAGTAAAATCTAAACCAATTCACCTGCAAGCTAAATC
TAACCTGAGCCTAGACTTTTTGAGTCCAGAGGATTTTCTTGAAATGTAGATTTTGGATTT
AGTAGGTCTGGGGTGGGGCTTCGATTGTGCATTTCCTGAATGCTGTTGCTGCTGATACAA
GGGCACCCTTGGATTATTCCTACCTTGAAGAGCTTCTAGCTACTCAGCTCTTCTGGGTTC
TTGAAGATCTCCTCATCTGTTTGAGGAGGAGGAAGAAGAGAATTACCCTTGGGAGACTTG
GAGAGCAAGAAAGAGCCATTCATTCACTCCTCAGTGGACGCTGCGTGTTTGCCTTGTGAG
AGCCTGGAAACTGGTTCCATCTCGGTTCCCAGGTTACGGCCTCAGGAGGCTGGTCCAGAA
GAACTAGTATTTGTTCCATGTAAAATAAGCTCTAGGAATGCATGGATGTGTTTCCTACAG
TATTCAGTCACCATTTAGGTCTGTCAGACATTTTGAAATAATTACCTGGTAATAATTCTT
AGGTTTCTTAGGCATCTAAAAGAGACATAAAGGCAGAAAGAGAAGTGCATCTGTCCTTAG
GAAGGAGTGTTTATTGGTGGACAGGGTTGTGTATGTTGTATGTGGGATGATCTCACCCAT
GTGGATGGGTGCATCTTCTACTCCTGTCACTTTAGATTCAAAGAGGCCCTGGGGCCAGTT
AAAGGTTCCTAGAGCTTTTGGCTATAGGCAAGTTGAAAATTCCAAAAGTTCTCAGCCAGT
CTTAGCTAGTGGAGAGCTCTTGGAATCTTTTACTGATATGGAAATAGCCAAGGGATCCTG
TGAACCCCAGACCTAATCGGGCGCCTCTAATGGATTACCTTGTCCCAGCATTTTGCTCTG
CTGCATGGTGTTTGGAGAGGGCATGGACACACCCCTGTGGATGGTTTTGCCATATAGCCC
ACAGCATGCAGGCAGACGAGATTCCCATGGAAAAGGTGGCTCAGCCTTTCTTAGCGGGAG
AAAGTGGCTATCGTACCTATGTTACATTCCTTCCCGCATCCTTCCCTTCTGGAGTTGTCC
TGCTTGGCTGCAAAGGAAGCTGGGAAGTATAGTCTTTCTGAAGGAAACTCTGGATAATGC
CATAAATGTTCCCAGATATCAGTCTTATCATTTCTGTGCAAACTATACTGACCATAACCA
GCGGAAGGTTGGCAGACCAAGACATGGTCTTAATGTTACAAAATTGGATTTTTAAACAGC
TTAGAGGAGATAAGTAACCTTAATTTTTTTTTTAATTTAGAAGATACAAATAGAAAAGTT
CTAAGAATGAGAATGATACAGGTATCTCTTTTTATATTCTTTACCTAAATTTAACCATTC
ATGACAGTTTTAAGCCCATTTTTGTACTATTCTTATACCTTTCACCTACACAAATATACA
AAGTATTTTTTCCTAAGCCATTCAAGAGGGAGCTGCATATATCTGTAATTATTTAACCCT
GCCTACATATGCATTTACTATACCTTAAGCAGGAACTTAGTAAATTTAACATGAACACAA
TACTTTTCGTTAACCTACCATCCCTAATCCAGTTTTACCAATGAACTCACATTTTTTAAT
TATTCTACTACAGCTCACATTTTTACCTATTTTAAAAATATTGTCCACAGAGTACTTAGC
ACATCCATGGCCAAACGTAGAGGAACACCACCCTTCCACAGTACTTCATTTTTTTTTTAA
CTTTAGGGTTTTCATTGTAATTTAGATGGGCATGTCGAGTGCATGCCTCCTGTGTATATA
GATGAACAGAAAGCCAGAAGGAATAGCTGATGTGACGATGTCTCCATAAATTTAAGCCCA
ATATCAATGTTTATTGAGAGCATCCTAGTCTGACCATTGATGGTTTTAGAGAAGAAAGGG
TAGATGCATATGAATTGGAGAGAAGAGCAATGTTGGCTTAGCTCAGCATTGTGACATAGA
CTTGTAATATTAGCTGCTTGAGAGGCTGAGGCAGGAGGATCATAAGTTCAAGGCCTGCTT
AGGCTACAGTTCTGTGTTTGTGACCAGCAAGGCAGAGGTAGAGGCTAGAAGAGCTTACTT
TGTTCAGCATTATTGACATTGTGTGGCTCTTAAATCTTTTCTTTAAAAAGATTTTTCTCT
CCCAACTTTTGTTACTTACAAATCATATAACTAAAGTCTAATGAGTCTATTCAGTGTTGC
TCCTGTGAATATGTTTTTAGTGTTGACCACTTGGCATTAGATAACCAGGCTGGGAAAGTC
TGGTTTCTTCTCCCCAGCCTCCAACAGCCATTATGTGGCTGTAAACTTAAATATATTTTT
AGTTCATGCACTTCAGTAAAGTATCAACAGATGCATTTGAAAAACATTGATGACCATCTG
ATGTAGACTTAAATTATTTGCATTGCCACTTCTTTTTTTTTTTAAGATGTATGTATGTAT
GTATGTATGTATGTATGTATGTATTTATTTATTTATTACATGTAAGTACACTGTAGCTGT
CATCAGACACTGCAGAAGAGGGAGTCAGATCTCATTACGGGTGGTTGTGAGCCACTACGT
GGTTGCTGGGATTTGAACTTCGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGA
GCCATCTCACCAGTCCGCATTGCCACTTCTTAAAGATAGGCAGATATAAAGTTTGATAGA
AAATTAGATAGCTTTAATATTTAATAGTGTAATCTGTAGGTAATTAGATATACACATGTG
CTCTTTGGGTCACACAGTGTTCTTCTGTTTTGTTTTGTTTGTTTGTTTGTTTGAGATAGA
GTTTCTCTGTATAACAGCCCTGGCTGTCTTGGAACTTGCTCTGAAGAGCAGGCTGGCCTC
GAACTCACAAAGATCCTCTTGCCTCTGTTTCCCAAGTGCTGGGATTAAAGGCTTGCCTCA
CTAGGCCCAGTGACAACAGTGGGTTTTAGAACTGAATTTGAACATGAACTAGAAGTCCTC
ATGAGGACTCAATCCAGAGGAGCTTGGCCAGTGTGAAGGAATGTTAGGCTAAGGCATACA
TCATCACATATGTGTTTCTTGGAACCCTTCACCCAAAACATTTAACATGCACATGATATC
AGGTTCGGACGTGCATAACTATTTTTCACAAGTAATTGTTAAAACTTATTTCCTGGCCTC
TCAGGATCATAGAACAAGAGGGGACAACTGTGTCCTATTAGCCTGACAAGTAGGTTGGGC
AGGATTTGTAATCTCATTGCATATTCGTGTTGTGTTCCTATTTCTAGGCCTTCTTCCCTC
CCCATTAACAGCAGCTTAGTAGTCTTTTCATTTATTTATTTTTATTTTTGAGACAGTGTC
TCAGTATATAGCCTTGGCCGGTCTTAAACTCAGAGATCCTTCTGCCTCTGTCTCCCCACT
ACTAAGATTAAAAGTGGGTGCCACCACACCGAGCTATGTAGTTCTTTAGAGACAAAGTCC
CACCACATAGCCCACGTGGGTCTTTAACTCATGGTCTTAGCTGATTGCCGCAGACCCTCT
GGGCCCCTTTGTCTGCGTGGAACGGGTCTCTAGTCTCGGGTGGACAAAGTGTAGGATGAG
TGACAAACAGACGCGCACAGGAGAGTTCGTGTGGAATCTGAGTGTAATTTTTCAAATCGA
ACATCAGACTTTTTATGCAGAAGACAATAAGGAAGTTGGGTGACATACCCGCAAGGTACA
AATGAGGCAACCGGATGCTTAATGACTCTTACACAGAACAGAGGAATGAAAACGCAAAGA
CTGGCAGGAACTGGGCAATAAAATAACTGAGACAAAGTCAGCTCTATCTAAGGTCAGCTA
TAGTCTTAGAAGCCAGGTGTGAGGACTTTTCACTCCTAGGGCAAGGGCTTTCACACCCAA
GTCATGGTTCTAACTAGGGAGTTCCGTTCTAGCTAACCATCTCATGAATAATGCAATACT
CTAAAACCACAGCTGGATCTACTTCCTAAACCATTGTAAATTCCTGTATATGGGAGTGAC
TTGGCTTTTGATAGTGTAGCACCAGAGGCTATTCTGAATGTCACTGAATAGGCAACACTC
TTACTGAATTCCAAGCCCATGGTCTTGCTCAAGGACATTCTAGGACTGTTGGAACACTGG
CGGAAGGCTTTAGCTATGTCAGAATTCAATCTTAAAAGGCACTTATGATAGGAAAATATT
GAAAGAGAGCACGTGGATCCATACACTAGACTAACCGTCTCATGGAAATGGAACTCGGGA
ATGAAAAGTTAATGTATGGGTAGAGAACACTAGACTCCAGGAGGAGAGCTTCCTTGAAAC
TCTTTTGCCTCATGAGTGACTTTTAAGCCTTTAGGCTTGTCCAGCTGACTCGACCAGAGA
GCGTAGCCGCTGATGTAGAGCTGGGGCTATAGGTTCCAGCCTAACCCTTCTGTAGGTTTT
CACTTGAAAATTCCTTATTTTCAGTAACAAAATGGCCTACCTTCCCTAGCAAAATTGGGT
GAAAGAAAGCAAGGAGGAGAGGCATGTGTCTGTCTTCTAGGAATGGCTGGTCTGCCTGAC
AGACTCCTTTTGTATTGATTTGGTTAAGTTTCTAAGAGTCAACCAGTAAAGGATGGTGAG
TGTTAGTACCAGAGCTCTTTCTAGAAGTAAGATTTTGAACAGCTTATTTCTGTGCCTGTC
CCAGGGGCATTCTAGCTAACAGACAAAATTAGTTCTCTGGAAACTGACTGTCATGTATTC
TAAAGGGATGTATGTAGCATGCAGTGACTGCCTGTAAGTGACTTATAAGCCATAAGATTT
TCTATGTATTAGAAAAGACAATGTTATGGAGACACACACCCCCTTACATATTCTTAGTTC
TGGGCTTTTTACTATGCTGTTCATTTTTCATTCACTATAAGGCTCTGGAGAAAAACCAGC
AATGGCTTGTGTATGATCAGCAGCGAGAGGCCTACGTTAAAGGGCTTTTAGCAAAGATCT
TCGAGCTGGAAAAGAGAACAGAGACAGCCGCTGCTTCCCTCACACAGCAGATGAAGAAGA
TTGAATCAGAAGGTACTGAGCTATACAAGTGGTCTTTTGGGATAAGCCTGACATTTCCCA
ACAGGAGTGATTCATCAAATTTAGACCTTTTTTTAATATATATACATATGTGTCAGAAAG
TAAAATCACATCATGTCTTTTAAGCTTCAAGTAAGAAATAGTCTGTTTCCTTTCCCCTTG
TTTTGAGATTAAAAGAGGACACAAGCCACATAGGTGAGACGGAATTATGAATACCTTTCC
CCTTTCTCAAAGTGCTCATTCCCTCCAGAGCTGACCTGGGTACCAGTTTCCTTTTGCGGG
GGGGGGGGGGGGGGGGGGGGGAGTGGATGACGGATTGAGATGAAGTCTTGCTAGATCATA
GTCCAGGCTAGCCTGGTACTTACCACGTAGCCCAAGCTAACTTCCAATTTTTTTGTTACA
GGTTATCTTCAAGTGGAGAAGCAAAAATATGATCATCTCTTGGAAAATGCCAAAAAAGAT
CTCGAAGTTGAGCGACAAGCCGTGACTCAGTTGCGTTTAGAACTCGATGAATTTCGAAGG
AAATACGAAGAAGCTCGAAAAGAAGTTGAAGACTTAAATCAGCTGTTGAGCTCTCAGCGA
AAGGCAGACATCCAGCACCTGGAGGAGGACAAGCAGAAGACGGAGAGGATCCAAAAGCTG
AGGGAAGAGAGCAGTATCTTCAAGGGAAAGCTGGAAGAGGAGAGGAAGAGGTCGGAGGAG
CTCTTATCCCAGGTTAGCCAGCCTGAGGTCTCCGAACTTCAGAAATCAACCAAGGCTAGG
GAAGCCCGGAGCACGGGCGAACCTGCAAGGGGCAGAAGCAGTCTCTACTATGGAGGCAGA
CCGTGCTTTAGTATCTAAATAGATGGATAAGCTCAGGAAGATAAAGCAGGATGGTGTGAA
AAGAGAGAACGGGCGCATGGCGGCCTCGCAGAAGGGATGGTATTAGACAGAGGATTGATG
GTGGGAATCTGCAGTGAGGCTGGGGATTCCCCATCAGTGGAGGAGATCACACTTCTAAGG
CTTGAGGGAAGAGTAGAGCATGTGGGAAGCCAGAGGAAAGCAGTAAGGGAATCCAGTCAC
TCCCAGGCTGCACTGGGAGTGCGCTGGTGTTGTGCTCCAACGAATGACATAGCACCTTCA
TGATTTGAGACAGCATGGTTTGGGCGTGTTAGAATTGAATACTACTGTGACAGAAAGTCA
TTAATGTAACTTTTGCTTGGCAACATGGAGGACTAGAAAGAACAGTGAAGTCCGTACCTA
CCTTTTCTGACACACAGCATTCACTATCAAATGCAAGATATCCTCTACTTGCCTCCTAAG
ACGACTGAGGAGTAAAGTGAAAGCACTTTGAAAACTAAGTAGATGCCAATGGCGGTTATG
GCTACTAGAATAGAATGTTTAACATCCCTCGGAAGTTGAGAGCTGAGGAACAGTCAGTAA
TCCTAACATTTGCTTCCTCCCTCTTCAGTCTGCTTACTTTGACTGATAGGTGTGAGTACC
AATATTTAGGAAATTAGGAAAGGTTAACTAGATACAAGTAAAAATGTCCCTGTCACTAGT
GTAAGAGATGAGGCACATCCTTCTGTTATCCTGCTCTGAAATGATGGCTAACACCAAAGC
CTCCAGGAACAGGGGCATGGTCACACAGAGCTGTACCCATCACTATGTGGCTGCTCAGGG
GACTCAGGCAGGATGCTGCTGCTAATCTTGCTTAAATAGAAAGCCTCAGATAATGAGCTG
GGATGAGTGTCACGCTTAGCAGGTGTTGTCCTTGTTACTGGGATGAGTGATGTGGGTTCT
TTGTCTGGGGAGGAGCAGGTGAGATAATGCAGGCTGTCATTGTATCCTCCAGGTCCGAAT
TCTCTACGATTCTCTGTTAAAGCACCAAGAGGAGCAGGCCAGGGTAGCTCTACTGGAACA
GCAGGTATTTACTGTGGATGCTCCAAAGGCCATTCAGCTGGTAAAAACCAGAACTCCCTC
TGGTATTTATACTGTTCTATGGACAACTACTTGAAAGTTGTAAACCAACTCTACACCATT
CATGTATCTGTACCTGTCCTTAGGCCAAACCGAGTCTTAGAGGTGTGGTGGCTGTTGTCC
TGACAGGTTGCTCTTCAGTGGCTGTAGTTCCTACTTCTAGCCTAACAGGATCTTTTTCTA
GGCCAGCTCGTAAGTTCAAGCAGAGCAGACACCATCTATTCTCACAATGTAGACAGAAAT
TCTTAATATATTTCAAACCAGGGAATAGCCATCTTTCCCCTCTTTTCCACACCCACCAAA
AATGCCAAGAACGTGAAGGAATAACCCCAACCAGCAACTTCTTAAGCTGCCTTCTGCTCA
TCCATACCTTAGGCCTTGGCTTTGCTGGTTCATAAAGCAGTGTTTGAGCCATAAACGTCA
CTTACTAACAATCTCACTGTGCTCACATGAGCTCTTGATAAGAAGGCCCGGCAAGTGTTC
TTGTGCTGACAAAGATGGTAAACATATAGTGAAGAGAACTGGGCACCATCTGCCAGCTCT
AACTGTCTCGTCCTAACATATTCCAGATGCAGGCATGTACTCTAGACTTTGAAAATGAAA
AACTCGACCGCCAGAATATGCAGCATCAACTCTATGTGATTCTTAAGGAACTCCGAAAAG
CAAAAAGTCAAATAACACAGTTGGAATCCTTGGTAAGCTTTGAATGGCTACTGTAAACCT
TATTCTTCATGCATGGATTTGGATTTATGGCAGGCTCATCTCCCTGGGCCTCTCATAGTG
TCCCATGCTAGAGCAAATTGTGGCTCCTAACCATTGCCCAGCCTCCGTGCTGGCACTGAA
ATGGGTCACACTGTGAGAAGGAAAAAAAGAAAAAAGGAAAAACTTATTCTTCATTCTTTT
TTTGCTACCTTCCCATTTGTGTCAGCTCAGTTTCCAAACCAGTTACATAGCTTAACCTAA
CCTTACAGCATCAATTCAGAACTCGGAAGGAGTGGTGCCGCGGCCCTCTTACTCATAGGT
ACTTTACTGATGTCTGGGACCATCCCTACCCAGGTTGGGTGCCACCATTCTAGTAGTTGT
TTGCAGAGAGGTGAGAAGGTAGAAAAGAGGACAGCATGACATTCTTTTTTTTGTATTTCT
AATGAATCTATGTGCATCTATGTCCCCACATGCCCCGTTAGTGCACATTCATGTCTTGTC
TTAGAACTACAGAATATTTGAAAGTAGAGAAATATTATAAATATAACTCCTAGTTCCTAA
GGGAGAGGAAAATATTAACTACTAAGTAACTGAAAATGTTTATATTAATAAAATAACTAT
CTTCATAATGTATATTTTTAAGGTTTCCTAACTATTTTAAATTCTTTTTTTAAAAAGCAA
AGTCTCAAAGCTGTATAATGTCCTGCTCATCTGTGTGTGTGACTTGTCTGAGCTACTGAA
AGTCTTGGCTGCTCTCAGTTTCGCATAGGGTTTTGTTGCTGCTCTGTTTTGATTTATGCT
TGTGCTGCCCAGGGTTGGTCTGGGGTCTTTGTACATCTTTATTCCTTAGCTTACTTCTGT
TTTACAAAGCTGGCAAACAGATTCACATTCCTGAAAATGTCATGATAAATCCCATTATTT
TGTGCAGTGAATTTAAGAAAAGGGAAAGGAGTGGTGTCTTCCCTCTACAGTCAACTCTGT
GCCTCTTAGCAAAGCCTACATACATGAGCACTAATTCATTACGTCCCTGAGTAATGAATT
AGTCACACCATCCAAGTGATTCATGACTACCACATATGTTACCCTTAAAATATTGATGAA
CAGCTGAGCAGTGGTGGCACATGCTTTTAATCCCAGCCCTTGGGAGGCAGAGATAGGCAG
ATCTCTGAGTTGGAGGCCAGCCTGGTCTACAAAGTGTATTCAAGATAGCCAGGGCTCCAC
AGAGAAACTCTTGTTTTAAAAAACAAAACAACGATAACAACAAAAATATTGATGAGCAGA
AATCCAACACAAACTGTCTGTAGGGCTGAAGCACGCACGCAGAGGATGTGGGAGCAGTTC
ACACTGCTGAGTGCTCAGGCTTATGTTCAAATGGTGTTCATTTGCCGTTTGTTTTGCAGA
AGCAGCTACATGGGTTTACCATCACAGAGCAGCCATTCCCACTCCAGAGAGAACCTGAAA
GCAGAGTGAAAGCTACCTCACCCAAAAGTCCCAGTGCTGCACTCAATGACAGCCTAGTGG
AATGTCCCAAGTGCAGCGTACAGTACCCAGCCACCGAGCATCGAGACCTGCTTGTCCATG
TCGAATACTGCATGAAGTAGCAGAACCATTCTTGCCTTTGTGCTGAAAAAGTCCACACTG
TATTCTATGTTTCTTTATAGGCACTTTAAACCACAGATGACATCTTTTATACAAGAAACT
CCATCTGCCCTTGGCACTCTGGCATATGAGGGCATCCTTGTATTTTTCTGGCCACTTTGC
ATTTCCTTGGTAGCCATTCCTCCCTGAGTTGGTTCGTCATCAGGCTGCAGTGACAGATTG
TGGTGAGCAGTGGCTATCCAAACTTGTAGCACTTCACGCTGTTGTAATGACTAGCATTTC
ACACGGTTCTTCTACTTGATAAACAGAGCTATTTGGGTTTTTGGTTATGGCTTAAAGCTA
CTGAGCAGTAAGCAAACATTTTATGCTTTGGGGGTTTTAAGAGAATCAGAAGGTAATTAA
CCATGGATCTTACTGTTTTGTTTTTTTTAAATAAGTGCTTTGTATACTGACACTTCCATT
TGATACCTCTTGCTATTGTAGAACGGTTACTAGCAAAGTTGGGAAGTTTTGTAATGTTGA
GTGCTGTTAACTGTTCTAAGCACAAAGCAGGTTTTGTTTGAAGAATGCCTTTAAGTGGCT
GTATATTTTTACTCCTATTACCTGGCCATAACTTTGACTTAAATTTCATTAGTACAGGTC
AGTTTCCTAAAATGCCAAAATGAACAAAACTTTAGCAAAACTATCTTGCCTCATTTGATT
TGCAGGGATTTTATTATATCATTTTGTTTTGTTTTGTTTTTTAGCACTCTTAAAGATGGT
TGGGCAGTGTAATTATCAGATGTTTGTTTTCTAAATAGATATTTTTATATATGCTTTATG
TAAACCAAAATGTGTTTTATTCCTTCAGATTTTCTAACATGCTTACACTTGGGCTACTAT
TTAGCAATATGAAGGAGGAAATAATAAAATTATTTAATAAGTTTTACTGTGTCTAGTATG
TGTGTGTATACATATATAGTCTTAAGAGCTCTAGTCACAGAGTGGTGTTGGGAGTCTAGG
TTGACACACATCATAAGGTGACAGGAACTGAGGAGAGAGGAGGTAAAGGAGTGGAGGCTT
TTTGGTATCTCTGCTGAATAGATAGCAACTCTTGATCAATAAATATTTTTCTGAGTTGTT
TGTTACAAAGGCAAAGCAACAAGCCTGTGCAGGTATATGTAATTTTGGCTTTTGTAATTT
GGGAGCATAAAAAAATACAGTTCTGTTATTGTAAATAAAATTTTGCCTTTGGAGTTAATA
ATCCCAGACTCCTAATATCTTCAACCACAGTTGAACAAAAGATACAGAAATATTTCTCAG
ATAGGTAGTCTGTATTCTGACCCACAGTGCTATCTCAGCTACCACATATTTAATTCAGTG
TGTATCAGAAGAAAATCGCACCCTTTGTAACTTGTAAGTAAGCCAGACATTGCTTCTAGT
TAATAGATACAGAAAATGACTTGCCCATTCAGAAGTACAGAGCAGGCCTTTGGTCTCTGC
CTGTTTGAGTCAAGGGGTTCTGCCCCAACCTACAGGGATAATCAGTGGGGACCCAGGGCA
GGGGAAAGAGAGAGTAGGAGCGACAAGAAACATGAAGAAAAAAACAATTCATGTTTACTT
AGTGCTTCTCCCATAGTCTAGCCACTCTTCCTACCTTTCTCAATCTCACAGTGCGGTGAC
ACTGCGGCAGTCTCTGTGCCGATCTTCACTCACTTCCTGGCGAAGCGGAGACCCAATGTG
ACGATTGGTCTCTCTCAGACCCAAAACTCAGAGGCCACATGCTGGACACCAGTTTGCCCC
GACCTGCAGGGATAATCAGCCAGGACCCAGGGCAGGGGAAAGAGAGAGTGGGAGGGACAA
GAAACACGAAGAATGAGAGCAAGTCAATCATACTGATCAAGCTCTGAACAACTTTATTCA
GGAGTGGCAATATAAGCATACGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 3750..3944, 6042..6317, 8564..8632, 15041..15191, 15601..15911, 17032..17103, 17726..17851, 19259..20382
3762..3944, 6042..6317, 8564..8632, 15041..15191, 15601..15911, 17032..17103, 17726..17851, 19259..19456
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved