Mus_musculus Locus Gas5
snOPY snoRNA Orthological Gene Database
Mus_musculus Gas5
Mus_musculus
Gas5
1
SNORD74, SNORD75, SNORD24
1229..1308, 1685..1746, 1892..1974
3144
TGTTTATTTTGGAGCCTACACCAGCGCCTTTTTTGTTTGCTCTTTCCAGCGATTCCCCA
GTGAGGAGGAAGCCCCTGGAGTAAAGTCTTTCTCTAGCGTCGGCACTGAAGGGGCGAGAG
CTGTAAAAGGGAGAATCGGGAACGCTGGGGTTGGCCAGTCGGGTACTGGGGAGGCCTCTA
TCAGTGTCAAGAAGCATGGGAAAAGGGGGACCTGGCTAAGCGAGGAGGTGGCACAGATGC
CGGGAAGCTCGACAGGAGCAGAGCCCCGCGGCAAGGGAGTTGCGGGCGCACAGGTGAGGC
GCGGGACCGGGAAGGGGGCGGCGCCCCGGGATCGGTCTAGGGCGGCGGAGGTTGCCGGGG
CGGGGGTGTGTCTGGGTGTGGCCCCGGCGCGCGCGCGGGGTCCTGAGGGAGGGGCTCGCC
AAGGGGGCGGGCCCGCGAGCTCGACAGCCCGGAGCCAAAGGGGCGGAAGGTCGCCGAGTG
CTGGGAGGGGAGGTGGGGCAGCGACTGAGCGCCGCAGGAGCTGGCTGCAACCCAGACGCG
GCCCGGGAGCGTCGGGTATGAGCTAACGGGGCGGGGGTGCGGGGAACGAGCCCAGTCAAG
GAGCAGCACCTACCTCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAACACCGTCCCGGA
AGTGAAACCCCCCGCCCCCTCCTCCGGAGCGAGCGACGTGCCGGAAGGAAATCAGTCACC
CTCACCCCGCCCCACCCCCAGCGCTTTCCTTGCAGGAGCCCCCTCCCCTCAGCCTGTACT
CCTCAGGGAGGCGGAGGGCGGGCCTATCGTGCCCGCGGCAACTCCGCCCTCCGGGCTCTC
GGGGGCGTGGCCAGAGGGAAAGTTTTGTGGGCCTGAAGAAGGTGGGGCTTGAGGAGGAGT
CTGAGGGCGTGTGAGGGGCGGGGTTTAAGTGGACGCAGCAAGCAGCTTTGCGTCTTGACG
TCACGAAGACCTTATATACTCGACTCAGCCGCCATCTCAGCCTTTCGGAGCTGTGCGGCA
TTCTGAGCAGGTATGCAATTTCCTGAGTATGTTATGGCTTCGGGCCTTGGAGGCTGAAGC
ACTGGAAGCTGGTGGGATTCCCGGCGCAGCCGGTGAGCTTAGTTCAGGGCACAAGCTGGA
AACTTTAGGAGGTTGGTTCTGCGTGTATTTGTGACATAAAATAGCATTGGGTTTTGGTCT
GGACACCAGACAAAGACGACTCAGCATGCGTGTTCATGCTATGATGAAGGCTATGTTGGT
AGGGACAACTGAGCTTGTTGATGAATACCAACGATTCTGATGGCAGAGCATGCTGAGTCA
CCTCGTGCACGGTTCAACGGGGGTGGAATGCGAAGCCACGCGGTGTTTCTTTCGCGATCA
CCATGGGATGAAGGCTTTTGCTAGAGATTGCCAGCAGGCCTTAGTCACTAACAAAGAGGA
CGATTGCTCTTGGGAAGTACCTGGATTAGAGACTTATATGTAACTGCTGGATATGTGCAA
CTCAACAGTGCCTATGTGGACGGAGTTCTTTGTAAGACAGGTCCATTTTGTGGAAGTAGA
ACTACTAAAGATTAACATTTTTCTTAGGAATGGCAGTGTGGACCTCTGTGATGGGACATC
TTGTGGGATCTCACAGCCAGGTAACTCAGTGGGGGAGGGGCATGACTAGAACATAATGAC
CACAAAGCCCATGATGGTATGAGAGTAGTGGACAGAAGGGATTTCTGAAAAACACTTTTC
TGAGGCTTTAATTCAGCTACTGGAAAGGGTTTAGTTCCGTGAAGAAGGGGACTGACTGTT
CACATCTCTTATTTCCAGTTCTGTGGCAAAGGAGGATGAAGGCTTACGAGGTGAGTACTG
AATAGTAATGAGAAGTTAGGTTGAAAGGACAGTGCCACAATGATGACATCATATTTGCTA
CTCTTGACAGCTGGGGTGACGATAGCTTTAAACCACCATGATTATAACTGAGGCACACAA
AATAATGATTTGGGGGCTACTTACAGAGTAAGCAGTTTTTACATAAAGATTCCCCCCCCC
CAGGACTCGTCAGGAAGCTGGATAACAGAGCGAGCGCAATGTAAGCAATTTTGTGTGTGC
ATGTGGTCCCATTACAAGGAATACCCAATGGCAAATGAGCACTAAAGATCCCTCAACCCA
CACATTGAATGTATTGTTCCCTGAGAGCAATTGTAGATAGAGGAGTGGGTGGGAAGTCTG
AAGTCAGGGCATTGTTTCTGCGTATCTGAGGAGGCTGGTTTTTGATATGTGGGAGCTAGT
GGTCGTTAACGCATTTACCCCCTATTTGGTGGACTCTGGTTCCCCCATCTTAAGTGCTGA
GTCAGGGGCCTAACCGGGCAGCTTTAACTATTTGTTTGTTGTAGGTGCTAGAATAGAAGA
CCAGAAAATGAAATGGTAAGTCAAACTAAAGGAATTGTAGATGCTAAACAGGCTTGGCTT
TGTTGCACTCTGCCAAATACTGGCCACGTGTTCCATCCTGGTCATAGCTGAACACAGCCT
GCATGATGACGAACAAATACTGACTACCTGAAGATCTTATTAGCTCTATCTGATGGTGGG
CTTCCTTGACATTTATTGTGGGGCAAACTCAAATCTGTTGACTGCATTGAAAAGCTCTTT
AATGTTTTTTTCTAGGTGGAGTTTGAGGCTGGATAGACAGTTTGAAAGGTAAGTATTGAA
AAACACTTGAATTTGGGTCAGTACAAAGGGACATGCAGAGACTTTGAATCATCAAAACTC
CAGCATGCATTGTCTTACGGATGTTTAGATAGGTGTGTTTTGGACAACACTCTGGGTTCT
TGTAATGATGTTGATCAAATGTCTGAGCTGAAAATAACTTGTAGACAATTTTTAACACTG
AAGAACCTTGTGGCAGGCAACTAAGAATAGTCGAATGATGTTTAGCATATTTGTAAGAGG
TATTTTCTTTTAATTCTAGTTAACTGGTTGCATGCTTGTTCATTTGGCTGGCTTGCTTGG
GTAAGAAGCCATTGGGGGCCTTGAATTCCCTCCAGTCATTTGCAGTATTTACTGCATAAC
ATTTAGCTTTTGAACATGCATGTGCTACCATCAGTACTAAATGGTGCCTTAAATTTTTTT
CAGGTACAAATAATGGTTTGAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1587..1639, 1818..1849, 2043..2144
1835..1849, 2043..2141
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved