Mus_musculus Locus Ncl
snOPY snoRNA Orthological Gene Database
Mus_musculus Ncl
Mus_musculus
Ncl
1
SNORD82, SNORD20, SNORA75
4035..4104, 8278..8357, 9064..9196
10869
AATACACAGAGAAAACCTGTCTCATAAAATAACATCTCCTAGGTCGGGCCAGGCGTGCC
GATACAGGTCGAGGCTAACATGGTCTACATGTGTGCTCTAGGACAGTAAAGAATAAAGTC
CTATCTCAACTCCGGACGAAAACTCCACAGGTCATTTCTAGTGGATGTTGTTAGCTGATG
AAGGGCGCCTGTGTGCTATGCTTGGAACCAGTTGGTTGCAATCCATTTAAAGCAACGCCA
GACAACTCTCTCGTTCCCCCCGCCATGGAGGGAACCTGTGAGCGTGGTCACAGGCGGGCC
GAGTACTTCTCCCCACCACACCAGGAAGTCACCTCTCTGAACCTGGAGTTATACCTACCG
CGAGAGGTCACCGACATTACATGGATCGCTTGTGCACTGCTCGTACACACACACACGCAC
AACTGCTTTTATTAGGAGCTCTCAGGAAAGCGGGGACTCGCATCATAGCCAAGAAGCCGT
TCGCGACTCCGCGGAGAACAGGCCGAGGCCCGCTCATCAGCCCGAGGGAACCCTAGGCCT
TCCGGCGTTCTTCAGCAGGACCACGCGGCGCGGGGGAAAGCACCGAGAAACGCCCAGACC
ACCTGAGCATCGCCGCCCATGCTGCCTCGGAACACCTGAGGGAATCCGGGCCACGCCGCC
ACCTACCCGCGCCTCACACACAAGCCGCGCCAAACTCGCCCGTCCCACTGCGCAGGCGTG
GGGAGAGCCCGGCGCTCAGGAGCATTCAAAGGACCCGCACACTGACCAGTCAACGTCCGC
CTGGGCCCAAACGAGTCCCGCCCTCAGGAGCAGACGTCAGGCCCCGCCCCTAAGAGCCCC
GCCCTCGTCAAGCCTTAGGCCCGCCTCACGCTGCCCCGCGTTAAGGCTCGCGGTTGGCTC
CGGGGACGGACGCGAGCTCTGGTTGGTGGAGCCGAAGTCACGAGGACCCCCTTCGTCGCC
TTTCCAGAGGCGATTACTGGGCAGGCTCAGTCTTTTGCCTCAGACGCTAGCTGTAGCTGG
CAGGCGGTTGTACGTGCTCCAGAGTCGTCGGTACCCGCTACTGCAGTCGCTTTCGTGTGG
CTTCCGCTGAGCTCTTCCGAGCTGCTCGCTCTCCACACGCGCCGCCGCCGTAATCCGCCA
CCATGGTGAAGCTCGCAAAGGTAAGAGGCCTTGGCGCGCCGACGCGGACGACTAGGCCCC
TGCTTTCGGAGGGACGCGCGCGCGCCCGCCCGTCCGTCGCGGAGGGGAGGAGGGCTTGCG
CGCAATCCCGGGCGCGTTCGAGGGCGCCATGCTGGGGGGGAAAGTCTCGCGCGACTAGCG
GGAGGTCTCGCGGTGCTTGCCCTCTGACTTAGGGGGATGAGAAGAGCGGAGGCAGGTTTC
CGGGAGGGCGATATCGAGGGTTCGGATGTAGCGGGCGGGAGGGGACGGTGTGAGGAGAGA
TCGGAGGAGCTGAGAGCGGATAGGGGCACGGCGTGGGAAGAGAGGGCCAACCTTAGGCGG
CGAGCGGTCCCGGGGCCCCGCCTCCCCGCGCACGTGCTCTGGTGCGCGGCCCGCCACGTG
CTCTGCGGAGCCCCGCACGTGTCGCGCGACCCGGGGCAGTGGGGGAGTGTCTGTAGTACC
CCGGAAAGGGGGACGGCAGCGTGGGGATGGATGGGTGGCCCGGCGATCTGCTGTCTCTGC
CGGTGACCGGGATGGACACGTGGTGGACCCCTGAGGTGGCGGCGTGGTGACTCCACGTGG
TGGGGCTGGAAGCGAGAGAAAGTGGGAAGCAGTTGGGTTACGTGGTGCTGCTTTAAGAGG
TGATTTCGAGATACCCCCTTCCCCAGCAAATAACTTAAAGGGATCCCTTTAACTGGGTTT
TTTTTTTTTTTTTTTTTTTTTTTTTGTGGAAGATGCCAGAAAATAGATGGCCACGACTAG
GAGACTTTATAACCTGTGGCTGTTTCTTGGTGTAGAGTTCTGTCTGCTCAGTTATCTGTG
AGAAGGAAAAAAAAATTATGCGCGGTTCGCAGAAAAAACTGCCAGGAGAATGCCATGCCT
GGCCAAGAAGAAGTCTTTATGCTTGTGTCCTTTAGTAAGAAAAAGGTGGTGGCCAAAGGC
AAAGTGACTGAAAATGCGTGCAATTTTTGTGTGCGTTTGTAGGCTGGCAAAACCCACGGT
GAGGCCAAGAAAATGGCTCCTCCTCCAAAGGAGGTGGAAGAGGATAGTGAAGATGAAGAA
ATGTCAGAAGATGAAGATGACAGCAGTGGAGAAGAGGAGGTAAGAAGCTATTTGCAGCAA
TAAACCGGTGGAATTGAATGTCTGGAAGTCTTAGAAATACAGGATATGTAGTAAATGGTT
GAATGGCAAGCCCCTTCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTT
CCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCTGCAAGACAGTCGGCAAAACAGGGGAC
AGAAACAGGCAGAATTTTGAGTTCCAGGCAAGCAGGGAGTAGTACATAGTGAAACCTTGT
CTCAAGACCGTTGTTATGGTCATGCTCAATCAGATTTCTTAGAAAAGCTCAGGTGCTGAG
TCCAGTTTTTTTTTTTTTAAAGTATTGAAAGCCATGTCTCCTTATTTCAGGGTTTAATGT
TTATCTTTGTGTGTGCGCGCACCCATTAAGCATGCTTGGTACCCTCATACTAGAATGTAC
TTGGATCCCCTGGAACTGGAGTTAAAGCCACATGTGAATGTTACATGTTACAAGAGTAAC
ACATGTGCTTAACTTTTGAGTCATCTCTCCAGTTCTTGGTTGTTTGTTTTTTTTTTTTTA
AGCCTATCTAATGTCCATTTTCTTGTGCTCAAAGTTAGTCTCTTAATGTAGCATTGGGTA
TAAAGGAATGCTTATGATTTGTTTGCTTTCAAGGTTGTCATCCCTCAGAAAAAAGGCAAA
AAGGCTACCACAACCCCAGCAAAGAAGGTGGTTGTTTCACAAACAAAAAAGGCTGCAGTT
CCCACACCAGCTAAGAAAGCAGCTGTGACCCCAGGCAAAAAGGCAGTAGCCACACCAGCT
AAGAAAAACATTACACCAGCCAAAGTCATTCCAACACCGGGTAAGAAGGGAGCTGCACAA
GCAAAAGCGTTGGTACCAACTCCTGGTAAAAAGGGAGCTGCCACTCCAGCTAAGGGGGCT
AAGAACGGTAAGAATGCCAAGAAGGAAGACAGTGATGAGGATGAAGATGAAGAGGATGAA
GATGATAGCGATGAGGATGAAGATGATGAGGAAGAGGATGAGTTTGAGCCACCAATAGTA
AAAGGAGTGAAGCCAGCAAAAGCAGCTCCTGCTGCTCCTGCCTCAGAGGATGAGGAAGAT
GATGAGGATGAAGATGATGAGGAAGATGATGATGAAGAGGAGGAAGATGGTGAGTTAGAT
CTTAGGATATTTAGGGTACTGCATGTACATTCCCTCACTGTTTCATTAGATTAAAAACTC
ATTTTGTGCTCTTAGTTCTTTCCATAACTTAATAGGTTTTCATTTGCTAAGTAGTTTTTG
TTTTTTTTAAGTATTTGTAGCATTTATCTTGTCTGGATTGGTAGGTAGCAAATACATTTG
CCTGATTTGCCATCTTTCTTCCAGACTCTGAGGAAGAAGTTATGGAGATCACAACAGCCA
AAGGAAAGAAAACTCCTGCAAAAGTTGTTCCTATGAAAGCCAAGAGTGTGGCTGAGGAGG
AGGATGATGAGGAAGAGGATGAAGATGACGAGGATGAGGATGATGAGGAAGAGGATGACG
AAGATGATGATGAGGAAGAAGAGGAGGAAGGTAACCATATTAACTTTTAAAGTATGCTGA
CCTAAGTAAGGCTTACTGGCTATGCTAAAGTGTCTGCTTACTCATGAATGGCATTTTAAA
ACATCTAGAACCTGTTAAAGCAGCACCTGGAAAACGGAAGAAGGAGATGACCAAGCAGAA
AGAAGCCCCTGAAGCCAAGAAACAGAAAGTAGAAGGTAAGCCTGCAAAACTGGGGAAACA
GATCAGAGTAGCACTAGCACAAGTGATGAGTGACAAAGGGACTTAATACTGAACCATGGG
GTTGAAATGAAATATGCTGATGTGCTTTATAGTTTATGATGAAATTTGTTGTGTGCTTAA
GTGGGCTGAAAGTTCATTTTTTGTGTGTGCAGGCTCAGAACCAACTACACCTTTCAATCT
GTTCATTGGAAACCTTAATCCAAACAAGTCTGTTAATGAATTAAAATTTGCCATCAGTGA
ACTTTTTGCTAAAAATGATCTTGCTGTTGTGGATGTCAGAACTGGTACAAATAGGTAAGT
TTTAATTGAATGTTACATGTGTATCAGCTAGAATTTTTACTTTCCAGTTGTATTCTTCCC
TGCCTTTAAACATGGGGCTATATCTAACTATGTTAGTAAAAGTCAGTTGTCTCCTCTCGT
GGCCTTAAGTACAGTTAAGGAGCTGCAGTAAGAAAGACTATAGTATTGAACTAAATCATC
GAGTCATAGGGCCTGCAATTTGAAGTTCCTGTGTTTGACTTGATAAAGATAAAATAAAAT
TTAAAGAAGAAAAGATATTAAACACATAAAATTTTGTGCAGTATCTACAACTATGGATCT
GCATAGTCATATGCTTTTAGCTAAAAGTATTCTCTGTACTTTTAGCGGGGTCCATGCTAG
CTACTGCTGTTAGTTACAATATACTGAATGAAGAAATCGAGGTGAATTTGTTGTAATGTC
TTGGTACATGGACTTGTTTTGTTTTTTGTTTTTTTTTCTTTAAGATTTGTTTATGTATAT
GAGCACACTGTAGCTGTCCAGATGGTTTTGAGCCTTCATGTGGTTGTTGGGAATTGAATT
TTTAGGATCTCAGCTCGCTCTGCTCTCAGTCCTTGCTTGCTCTGGCCCAAAGATTTATTT
GTTGTTATACATAAGTACACTGTAGCTGACTTAAGATGCATCAGAAGAGGGCATTAGGTC
TCATTATGGGTGGTGGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCAG
AAGAGCAGTCAATGTGCTTACCCGCTGAGCCATCTCTCCAGCCTTTGGACTTGGTTTTAT
GGAAGATAAGGGTGATCTAGTTTTATTTTTGTTAGTGCTGTAGATGCTCTGTGTGTGTGC
CACATGGTATAAGTGCAGATCACCTTCTCATACCTGTAATCTTGTTTTTTCCATCTTCAA
GGAAATTTGGTTATGTGGACTTTGAGTCTGCTGAAGACCTAGAAAAGGCCTTGGAGCTCA
CTGGTTTAAAAGTGTTTGGCAATGAAATTAAACTAGAAAAACCAAAAGGAAGAGATAGTA
AGAAAGGTATGTAAGGGGGTCTGGGTGACTGGATACTAACAGACTTAGGCAGTCTGGTGC
CTCTTCCTTAGTTTCATCCTCATTGTGAACCAATGAGATGTCATAGGTCATGTGCTTGTT
GACAGGTTTGATTCCTGGGATATATAATGTCAGGGCTGACAGGAGGAATAGCTTAGTGAG
TAAAGATGCTTGCTGCAAAATGTTTGATCTCTAGAAGCCACATGAAGAGAGAAGAACCTT
TAATCCCAGCATTTGGGAGACAGAGGCAGGCAGATTTCAGAGTTCGAGGCCAGCCTGGTC
TACAGAGTGAGTTCCAGGACATCCAGGGCTACACAGAGAAACCCTGTCTCGGAAAAAAAG
TTTTAGCTTATCCTCTGACCACATGTGTATCGTGACATGCTTGAAGCTTACGTATCTCTT
AAATGAATTCTTGATCCCTATATTTTGAGTTTCAGAATTTGGATTTTAAGTGTTTGTTTC
TTAGTTGTGCTGAAAATTGAACGTGGGCTTTTCACATGCTAGGCAAATTTGTTGGGTTTT
TTTGTTTGTTTTTTTCTCAAGACAGGGTTTTTCTGTGTAGCCCTGGCTGTCCTGGAGACC
AAGCTAGCCTTGAACTCAGAAATCTGCCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGAG
TCACCACTGCCCTGCTAGGCAATCACTCTTAAAACTGCTACATATCCTCTGTCCCCTTTT
GCTCATTTTACAAGGTTGCTGTGTGCTCAATCTGCAGTCTATGTTATATGCTTACTGGAT
CTAGGCTTTTGATGTAGAATGAACCATATGAGTGATGAGGTATCTTAGAGATGGAAACTA
AGTCTAAATAGACTTGTTCCATATACAACTTAATACATATGGTCTAAGGAACATGATATA
CATGTAAACAAGTAGGAAGGAGATAAGTCTGGTGTCCAGGGAAGCCAGGAGAGCCTCATC
TGAAACTGGACAGGGGTTTGTGAGTCATCAGGTGACAATTGAACATGGGTACTCTTCATG
CAAATGGTTAGTAACCATTGAGCCACCTCTCCATCCCTTTATACCATTTTTTTTTTTTAG
CATATATCCTTGTACTTTATAGGAATTATTTGCTTTATTCTCTTGTGACTTGTAAATTGA
TGTACTTAATTAAATCTTTTTCCAACATAGTTCGAGCTGCAAGAACACTTCTAGCCAAAA
ACCTCTCTTTCAACATCACTGAGGATGAATTAAAGGAAGTGTTTGAAGACGCCATGGAGA
TCAGATTAGTCAGCCAGGATGGGAAAAGTAAAGGGTATGTTTTGTGTCTTTGAGTGTTAA
AGTTTTATTAAGTTTAGTGTCTTCTTCCCCTCTCCTTGTCCTTGACAGTCTCTAGTCTGC
TGCTTCAAACTTAACTTCATAACCAGAAAATTGAATATCTGGTCCTCTGGCCTCTACCTC
CCAAGTTCTGACATTAAAAATGCTCAACTGATGGGTTTTGAAGCTGTGATCAATTTTACA
GGCTCAATCCAAATTGGCATCTTTTGCCACAAGTACTATCCTTCCCTATTTTATGAGAGA
AATGTGATTCTAGGCAGTTCAGTCTATTGTGTTGGCTCTTTTTCCTCCTCACCAGTTTAA
AGGATGAAGATGAGCTAATACATAGTAAAAGAACAGTAAAAGCACATGTGACTAAGTCCT
TCATGACTGATGCTTGAGTAATATTTTCTCTAACGTAGTAACTGAATTGTCTTGTACTCT
TTCAGGATTGCTTATATTGAATTTAAGTCTGAAGCTGATGCAGAGAAAAATTTGGAAGAA
AAGCAGGGGGCAGAAATTGATGGACGATCTGTTTCACTCTACTATACTGGAGAGAAAGGT
CAAAGGCAAGAGAGAACTGGAAAGACCAGCACTTGGAGTGGTAAGTTAAAGGGTTTATTG
TGTAGTGGGAACAGGAATCATTTGTATCTTTGTATTTTAAGTAATTGGTTACCTACAATT
AGTTCACCTTTGTTCATATAGCTGATGTTTAGTCTTCATGAGTGAAAGCTATTTGAAATC
ATTTCCTTTGGAGTATAGTAGGCAAATAAAGCTTTTTGTTGGGTATGTTTTCTACTTTAA
ATGGCTTAAACTATTTTAGAAAATAGTGTAAGACAACAAAGAACAGTTATCTAATTAGAA
TGAAAATGAAAGGAGCAAAGAAGGCATTACTGTATATAATGGATATACACTGGTGGTTCT
AGAATTATGGTATATGGTACATGGTTGAAGTGCCATTGTTTCAGTTAACATTCCAGTAAC
CTTGTGGATTAGGTTGGAGACATGCTTTATAGGTGACCCACTTACTGAGTGTTTAAATAT
ACACAGACATACTCTAACATACCTTGCTAATGTGTTATCTTTGTATTTGCAGGTGAATCA
AAGACTTTGGTTTTAAGTAACCTTTCCTACAGTGCAACAAAAGAAACTCTTGAGGAAGTA
TTTGAGAAAGCAACTTTTATCAAAGTGCCCCAGAACCCACATGGCAAACCTAAAGGGTAA
AATAATTTTTACGTTAGATGTGGGCTGGACATACATACTCTTACGTATAAGAGTAAGACT
GTCCTGTTAGCTTAAAAAAAAACTAAAGTTTTAGCTATACAAAGGGCAGTAAATATTGAT
AGTAAATTACATGCTGATGCCAAGTGTTTCTAAGCTTTATTCTGAGAACTGACTTTCAAC
CTTCAGGTATGCATTTATAGAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAATTC
CTGTAATAAAATGGAAATTGAGGGCAGAACAATCAGGCTGGAGTTGCAAGGATCCAATTC
GAGAAGTCGTAAGTCCTTTGACATGATATGACTTGGTTGGGTGATATTTTTTTTTATTTT
TATGTGCCTATATGCTCATTTGGGGCTGTCTTTATGTTGTTGCTGAGAAAATGACAACTG
GATATGATGACTGATTACCTGAGAAATAATTGATGAAATCTCAAGAAAATTCCTCTAGAT
AGTCAAGTTCTGATCCAGCTATGTCAACTCAAAGCAGCAACCTTGATTGCCCTCTGAGTA
CGCTTTTTTTTTGATCCAGTGTAGTCTTTTTTTTTTTAACCTTAATTTCTTGTGTTAATT
GCTTTTTCTGGTAAAAGGGGGAAAAAAAGACATAACAAAATCAGTGTAAGGGAAGGCTCA
GTGGTTGAGCACTGAGAGGACCTGGGTTCAAATCCCAGCACTCACATGGCACCTATCGAG
ACAGGATTTCTCTGTGTAGTCCTGCCTGCCGTGGAACTCACTCTGTAGACCAGGCTGGCC
TCAAACTCAGAAATCTGCCTGCCTCTGCCTCCTAGGTGCTGGGATTAAAGGTGTGCGCCA
CCACTGCCCAACCCTGTCTGTAACTCTTAAGCTCTGACATAGATTGCAGACAAAACACTA
ATGCACATAAAAAATTTTTTTTTTTTTAAAAAGGAATCTACTTCAGCTGAATGTGGCAGT
ATGGCAGTATTCACCAAGGGTTCATAGTGAAACAGGAATTTTTCTCTTCCAGAACCATCC
AAAACTCTGTTTGTCAAAGGTCTGTCTGAGGATACCACTGAAGAGACCTTAAAAGAATCA
TTTGAGGGCTCTGTTCGTGCAAGAATAGTCACTGATCGGGAAACTGGTTCTTCCAAAGGG
TAAGAAGGCGTAGTAGTGTTGCTGCTTTTTAGTGAATTCTGCATGGAGAACTTGGGTCTG
CAGTATCTTCTCATTGAGCTCCTTTCTGTCCATCAGTGATAGATTATGGATTCGCACGAG
AAGAAGAGAGAATTCACAGAACTGGCACTTATCTTCTGTTTTTGCAGAAGTATATTTGGC
TGTTGTGTGAGACATTATGAGATACTGGCGATTTTCTCGACCTGAAGAGTACTTTGGTCA
CTCTACTTGGGTGACTTGGTACTTATTGTGTTACTTTAAAATGTGTTTACTTAATGGGTG
AGGTTTTTTTGTTTTTCTTTTCTGTTTTAGGTTTGGTTTTGTAGACTTTAATAGTGAGGA
AGATGCCAAAGCTGCCAAGGAGGCCATGGAAGATGGAGAAATTGACGGAAACAAAGTTAC
CTTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTTGGTGGTCGAGGTGGAGGCAGAGG
AGGTTTCGGAGGCAGAGGTGGAGGCAGAGGTGGAAGAGGTGGATTTGGAGGAAGAGGCCG
GGGAGGCTTTGGAGGTAAGGAAGGGAAAGGAACTGGAAACGGATTCCTAAACCTGTGTCC
TAACCAACCACCTTAAATGGGAAGGTCAGTCCTAATTGTATCACCCTTTGATGTTTTTCC
TTCCTATAGGTAGAGGAGGCTTCCGAGGCGGCAGAGGAGGAGGGGGAGACTTCAAGCCAC
AAGGAAAGAAGACGAAGTTTGAATAGTTCCTTCCATCCCATTCTTTCCCTCTTCATTTTA
AAGAAAGGACTCTGGGGTTTTTACTCTGTTACCTGTTCAATGACAGAGCCTTCTAAGGAC
ATTCCAAGACAGTAAAGATCCTAAACTCTGTTGCCAGACTTAATACTTCCTAGAGGTTAC
ATTTGGATTGTTGCTTAAGAGCTTGGCAAGACCAACTCTGCCCAGTGGGAATTTCAGTTG
TGTTCCTACTGCTTTCAAGAATTCCCAGCTACAAATGTGGAAATTGGTGGGGAACAGCTT
CATCATGATTCTGATCTGGAAGATTTAATTTGTATCTTAGAAGGGTGTGTACTGGAAAAG
TGGTTGATAGAGCACATGGATCAGTGCTGGAAATACCATACAAGAGCTTGTGTGGTATGT
AATTCTATTCCCAGCATAATAAGAACAAACAGTACAGTGCAATCTGAAATGACCTGGACA
AGGAATGGTACCCCATTGGGTTGAAAAATTCACATAGCCAGGATGGTTGCACATGCCTTT
AACCCCAGCACTTGGGAGGGAGAGGCTGGTAGATCTGAGTTTGATCTGGTGTACAGAGAG
TTCCAGAACAGCCAGGGCTGTTTATTAGAGAAAAAACCCTGTCTTGAAAAAACAAGAAAA
AAAAACCTCACAGACAACCAAATACAGAGTTTTAGCCACTGAGTACCAAGTCTCAGCAGC
AAGCTGGGAGTGACGTAATCCAATCCCATGGGAGGCTAAAGCAGTCTATGACTTCAATGC
CAGTTGGGTCTGCAGAACTGAGTTGCTGGATAGTGAGGGATACTTAGAAACTTTGTCTTG
AAAAAAAAAACAAGACCTGTCAAATTTGAGAGAAGCTTTGGGAAACAAGGTTTGTAAGTT
CCAACAGAGGGAACAGTGGCCTTTTTGACTTAAAGGTTGTCAGAGGTCCAGTTTAACTAG
GGATAATACAGTGGCCCTTGGCCTGTGTACTTAATGAATTTTTCAGTGATCTATCAAGGA
TGTTTGGTTTTTTTGTTTTTTGTTTGTTTTGTATAAGGCATGGGTGCCTAGATAACCTTA
ATAGAAACTTTCCTGTAGGTGTTTTTCCAAGTCCCACTCCCAACAAACTGATTTTCAAGA
AAGACCAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1159, 2142..2258, 2913..3408, 3624..3809, 3908..3994, 4172..4313, 5221..5345, 6510..6633, 7085..7239, 7732..7855, 8046..8167, 8872..8998, 9330..9553, 9669..9869
1142..1159, 2142..2258, 2913..3408, 3624..3809, 3908..3994, 4172..4313, 5221..5345, 6510..6633, 7085..7239, 7732..7855, 8046..8167, 8872..8998, 9330..9553, 9669..9742
NM_010880.3
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved