Mus_musculus Locus Eef1b2
snOPY snoRNA Orthological Gene Database
Mus_musculus Eef1b2
Mus_musculus
Eef1b2
1
SNORD51, SNORA41
2513..2590, 2840..2971
4488
GTGGAATGAATAAAATACTACCCAACATGATCACCGGGCTAGACAAAAACAAACAGTAG
CGTGGACAGGTTCAAGACAGCAACTAAACCGATGCCTGAGGTTTAAGTCTCTCGTGACCC
TGGGAGATGAACCGGTCTCCTGATGACAGGGCCATCTCCTGTCTTCCCCTGCAAAGAGAG
AGTAGCTCGCAAGCCCGGACTCCCAAAGGTCTCCTGATCGGCTTAGGCTCCATCAGACCA
GAAACCAAGGCTCATAACCCTCACCTGCCGGCTCTCCCGGGTTCCAGAGGTGGCGGGGCA
GGAGCTGGTACCCAGTCAAGGGCAAGAGGAGAACGGCTTGTCTGACCTATGGGATGCAGA
CCTGCCAAAAAAGAAAACACCACTCGAAGCGCTTCAACTTGCCCACTTCAACGCGTCCTC
ACCTTTCCTCCGGAGCCCACCGAGTAGTTCCGCGGACCTGTCCGGGTCTCCCTGACCCCT
CAAAACCCTGGCCGCTAAGTCAATATGGCGGCCACGGCAACCTCTGTCAGCCCGACCTGG
AGGACGGAAAGCCAGGAGGGACTAGAAACACAGATTCGACTGTTTTTCCCCGTCTTCGGA
CCTGTTCGGCAATTTCCGAGAGCGAGCCCGGGAGGAAGCGGAGAAGACGACTTGGACCTG
CAGTTCCGCCGGAAGTAGCCGAGGCCTTGCGTCCGAGCGCTTTCGTTCAACTCCGGCTCC
TCAGAGGGCGTTTCCCTTCGTTTCGGAGTCCTTGGAGCGAAGGCATTTTAAAATGCCTCC
TTTATTAATTTTCTTCCAAAGACAAGGGAAGGCCGGCGGACGACCTGTGGGCCCTTTAGT
TACCAAGTCGCAGTGGTACGCGGAGGACCGAGACTAGGAACGGACCTTGACCTTTAACCT
CTAGCCGGGGCGGCGGAGGGAAACGCCTCCGTCTCTATATAAGGAGTTTTCCGGACGCTC
TGGGTCCTTTTTTTCCCTCAGCGCTGGCCGCGGCCTCCCGGCGCTCTCGTCCTCCGCTTT
TGCACAGCTCCCCGTTCCAGCCTTCGCCATGGGATTCGGAGACCTGAAAACCCCTGCCGG
CCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATTGAGGGGTGAGCAGGAGC
CGAGAGGCTGGGGGGCCGGGGCCACGTGGCGCGGGCTCGGCGGGAAGGAAGCGGGTCTCC
GGATGCTGGGGGACGCCGAGTCAGTGCTCCCGGGGCCGGGATGCCAATGGAGCGGGACCT
CCCGGGAGGGGCTGCCAGCATTATAATTGAGATGATGCTTGCTCTCCGTGTGCCCACGTC
CAGCTGGTTCTTCCGCGTCTTTGGACAAGTTAGTTTGTTAGTTGAAACCTGTGGCAAGTC
TGGTGGGATGAGTTCTCCTGGGTGGCAGATAGTTCTTGGGCTTGCCTAGATTCAAACATG
TTCTGTGTCCTTTCAATGAGAAGCAACTTAGGCTAGCCCTGTAATTGTTCTCACTAGTTA
GCTTGACGGATATGGGCTATGTCATTTACCAGCTAGTGTTTGTGTCTTTTCTTTTAAAGG
TCTGTGCACTTGTTTTTGTGTCACTGGCAGGTACGTGCCATCACAAGCAGACGTGGCAGT
ATTTGAAGCAGTTTCTGGTCCACCACCTGCTGACCTGTGTCATGCCCTACGTTGGTATAA
TCACATCAAGTCGTATGAAAAAGAAAAGGCCAGGTAAAGGTATCTTTGTGCTACCTGGAT
TTTCACATGCAAAGTAGGGACCGGGTTAAAGTTGGCTTTAGCATTGCTGACCTAGTGTGA
GCTGAATTTCTTTGTGACCTTACAAGGCCAAGAGACTGAAGTCCTCCATTTTCTCACAGA
ACAGGTAGAACATGGACAACCGCAGTTCACCTTTCCCACACCTCTCTGATCATGTGCTTT
GGACCTGGGGGGGCCACCGCTGGGGTGTGAGGGTAGCTCGCTCATTCGGTCCCTGGCCAT
TCTTCTGAAACTACCAGCAAGGGTGGAAGTTTGGGGAAGTGGATTCCAGTTCACTAAGAA
TGGAAGTGAGCATACTTAATGAAATCTCAAACAGATGTTCATTCTGAAAGAGTAAGCCGT
AGTGAGTACTGAATACAATGTCTCCCATGGGTGAAGAGTAAAGTTATTTGCCTGGGATTG
TGCTAAAGGTTAAATAACCAGAAGAGAGTGGGAGTTCCTGGGAAAGGAAGATTGTGTGTT
TTGCCTAGAAAGGGCTTTGACACTGACCTAATGTGGCAGAATGTTTGTTTTCAAGCCTGC
CGGGAGTGAAGAAATCTTTGGGCAAGTATGGCCCTAGCAGTGTAGAAGACACCACAGGAA
GTGGAGCTGCAGATGCTAAGGATGATGACGACATTGATCTCTTTGGATCTGATGATGAGG
AGGTATGACTTCATCTTTATCCAAGCATATTGAGAAGCCTGAGGACAGATGCCATAGCCA
CTCCCTGGATGGATCCTGGCGTGGCTTTATTGTCTGCCTTTTAAAATTTATCACTGGGTA
CATGATGAATAAAATCAAATCACCTTCTTTCGGCTGAGCTCCTGATGGATTTGCTTTTTC
TGATAAATCTGGTGGGTTTTGTGATGACCTTGTCACTACATTTAAGCAGAAGATAACCAA
CTTTGTGAAACATCTTTTCTCTGTACAGGAAAGTGAGGAAGCAAAGAAGCTACGAGAAGA
ACGCCTTGCACAGTATGAGTCCAAGAAAGCTAAAAGTGGGTAATCTTCATTGTTAGTAGT
GTTGATTTCAGGAGCTTGTCCAGTGCTTGCCCTAAAGTGGATTTTCCCCAGTTAAATTGA
ATGGGTCAATATTTTAAAACTTCCACAGCTACTGGTCTACAGCTGTCTTTATGGTAGCAG
TTGTAGCATTCCTCTGTGGGAAAGAAACTGTTACACAATTTAATGCCTCTTTCTTAGCCA
CACAGGAGGAGGATTATGTGTGACAGACACAAGGCAAATTGTGTGTGTGTTTGACAAAAA
GATGGTCTGTTTTAAAACAAATTTGAGATTTGACTTAATGGTGAAAGTGTTGAGTGTTTA
GGTGCACTTCTTAATCTTCCTTAGAGCCTGCAGTTGTTGCGAAGTCTTCCATCCTACTAG
ACGTGAAGCCTTGGGATGATGAGACGGACATGACAAAACTAGAGGAGTGTGTCCGAAGCA
TTCAAGCAGATGGCCTGGTGTGGGGCTCCTGTAAGTGTGATGCTTGTGTTTTAGGGATTT
GTGCGTTTTCCCGTAAGGATTTCCTAACATTTACCCCTTGATGTTCTTTTTTAGCTAAAT
TGGTTCCAGTGGGATATGGAATTAAAAAGCTTCAAATACAGTGTGTAGTTGAAGATGATA
AGGTTGGAACGGATATGCTGGAAGAGCAAATTACTGCTTTTGAGGACTACGTACAGTCCA
TGGATGTGGCTGCTTTTAACAAGATTTAAATCATTCTTAAGTCAGTGCACTTAAATAAAA
GCTTGAAAGATAACCCTTGGCTCTTCATTTTGCTGTGAAATGGTATGTCTTCATTTTGAA
GGAAAGGATTCAGTGTAACTCATTAGTGGCGAAAACTTGAACTGGAAAGAGAAATAGCTC
AGCATTTTTAAACCACTCAGCTTGATGACCAGACCAACCTGAAGTTGTCTTTTAGCCAAC
ACTGTGTGTACCATAGATATAATTAAAAGGAAGATAAAGAACTGATGTGTTATTAAAGAT
TTAGCAATTAGAGTATACTTTTGTGATTAGTGAAATAATTCTTTTGCTGTTAGCAGTACA
TGATACTATTGATAAACTGTCACTAGATGCCTTCGATGTCTTTCTGAAAAACTGAATCTT
GGGCTGCTGAGATGACTCTATGATAGCCACTGAGGTTGCTTACTGTTTGGTTCACTCCAT
AGAGTAAGAGCGAAACTCTAGAAGGTGCTCTGATGGCCACGAGCACAACACCTGTACATA
AGAGTTTTTGGAAGTGTCCTGAAAGGAACATTGTAGGCTCATAAGGTGGTCAAGTGTGGG
TTTTCAGAACTCAACCTAGAGATGGAGGGAAGTGCTGGGGGAGGCAGTATGCGCAAAGCT
ATTCCTTGGAGACACTTGTGGGAGGTTATGCTGCTCTAGAAGTACGTTATGAAATGTATC
ACAGGGCTGGAGAGATGGTTAAGAACACCAACTGCTCTTCTGAAGGTTGTGAGTTCAAAT
CCCAGCAACCGCATGGTGGCTCACAACCATCTGTAATGGGATCTGACACCCTTTTCTGAT
GCTTCCGAAGACAGCTACAGTGTACTTAGATATAATAATAAATAAATCTTTTTTAAAAAA
ATACATCACAGCAGTTTCAGCTTTGTGTTAAATTTTTGATATCTAAACATTTACTATAAT
TTTTACTGTTTGGGCATTTTTTTTTAAATAAATTTTATTTTATGTATATCAGTACACCGT
AGCTGTCTTCAGACACACCAGAAGAGGGCATCGGATCCCATTACAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1590..1712, 2275..2401, 2668..2734, 3084..3209, 3294..3488
1048..1127, 1590..1712, 2275..2401, 2668..2734, 3084..3209, 3294..3445
AF029844.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved