Mus_musculus Locus Rpl21
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl21
Mus_musculus
Rpl21
5
SNORD102, SNORA27
2690..2760, 3000..3128
4841
GGATACAGTGGTTTTCAGAGTTCATAAATATTCAAGGATGAAGCTTGGAAGCAGGCAGA
AGACTCCGGTCAGCAGGCTGTCCGTGAGCATGGCTTGGCAGAGATCTCAGCTTAAGACGT
GCACTCACTCCAGCCTCCTGGCTGAACCAGCACGCTAGTTTCTTGTTTTGCTGAAGGTGG
GAATTACCTTCCCAAGAACGCATACTAAGGACAGAAATTAATGTCTCCAATTTTAAGTGG
GGCACTACTGCATATGTGGAATGACGATCCGAATAGCTATTATAAAAATAACAATGTTCA
TCTCTCAAAGTCCTCATCTATTATTCGAGCGCTCGTAATATCCAATTCGGTTATCCCCAT
AGATTATTAGGAATACTGCTTCCAGTATGACTGACTAAACACCCTTATCTACAGCCAGGG
AGACAGGAAGGGAAGGAAAAGGCTAATGGGGTGCCTATGATGAGAGTACTTTACACACAC
GCCTGTCTTAAGATGTCAAAATGAAACCTATTATTTTGTACAATTAATAGACAAGATAGG
CTAGTCTCTAGATAGGCTCGAGCTACAGGTATGAGAGGAAAGAAAACCAAAGTGAGGCGT
TTTGTTTTGTTTGAGACAGGGTCTCGCCTATGTGGCTCAGGATGGCCTGGAAACTCAGGA
GACACTAACACTAACAAGTACCACACCGCAAAACGCTGGGCAACCCAGAGAGGCGGTGCC
TCCTACGTCACACGACGCAAGGTAACGTCAGCACGCTACGGAAGTCGCGTCCGGCTCCAC
GCCCGCGAGGGCCCCATTCCGGGATGTCTAGCAGGATGCCTGAGTGAGTTTCTGTTGGCC
TGCTGCCTTTAATCTGCGCCGGGGAGCGTGTCCTCACGGCGTCTCCAGGTTATCGGGACG
ATGAGGTTCTCTCGACCAGCCTCGCGGGCCCGGCGTTTCTCTTCAGGCAGCTTCGCGGGC
AGCCCTCGGGCCTTGTAAGAGCGCGCAGCCCCGCCCTCCTCCTTTCGGCCGCCGCAGCCA
TCTTCCAGGTTGGTACGCGCGTGGCTCTCTCGTCTTGTTCTCCACACACGCTGCGTGTGG
CGCCCACGCCGCAGAGACTGCGTGTTAGGGGCGTGGGGAGACCGTCTGGAGGTCACTGCC
CTGGGCGGTGTATGCTAGGGAGCTTCTATCCGGGGGAGCCGGGCCTGGCGCAGTCTTGGT
TGCCGGGCGTCCGCCCAACCCCAGACTTGAGCATGTGCTGTCGGGCTGGGACTTAGGATT
CTGCTTGGGTCTTAACGATGCCGGGGTGCCGAAGCCTGGAATTGGCTCGGGCGAGGAGGG
TGCCCGCCGGGTCAGCCTGGTAATGATGTAATGGGGACCCTTCCTCTGGATACATGAAAC
ACTTAGGAATTTTGGCCCTAGAAGACGAGCGTGGGGAAGGAAGGTAACATTAAGGCTGCT
TAAGACTACAAGGGCAAGGGGTTATGTCTAGTACACCATGCTTTGGAGCTTCCCTTGTGG
TTAGGAATGGCGGGTATTTCTGCCCTGGATGACTGGAGTAATCCAAACCTTGTTGGTTTG
TGGGAATACACGATCTGGTTCTAAATATGTGTAGTAGGTAAGTTCGTAGATGGTGTTAAA
TTAGCATTTAAATTTAGTTGGAATGTGGTTTTCTATGCATGCTTCCTAATAGCATTCGAA
AGTGCAGGTGTGCGATTAAGAGATTGTTGATAGAAAGCTACTGTAGTAAAATGGAATTAA
ACAGCATCAAAGAGGCTGAGTTTGGTGGTCTTCAAGTTACCCTGGAGTTGCAGGTTGCAA
TGTATTGGCTTAAGTTCTAGCATCCAGTCTGATGGTGCTAATGATAGAATTTGGCCTCTT
TTGCTAAGAGGAATTGTGGGCACCCATTTTCAATTCCTGTGATTTGGAAGGTTGACGGAG
GTGCTGAGGTTGAGAGGGCCTGCCCTGTGCGACAAGATGACTTTTGGGGGTGTGGTTATT
GGGACAGTTAATAACATAAACTGTGAATTGTTATTTGACTGATAACTTTTCTGGTTTCAG
TAACTCGCCAAAATGACGAACACAAAGGGAAAGAGGAGAGGCACCCGGTACATGTTCTCT
AGGCCTTTTAGGAAACATGGTAAGTTTGTTATGTCTGTGCCTGAGGAGAAGTGGCATGTC
TTAGTCTGGCTTTGCTTGTCAGAGACATTGTCCTTTACAGTGTATGTAACTGCCGAATGT
GGACTTGGGTTGGAAACTGGTATACTCATGAAAGTGTACCTGTGGTTCTAGAAGTCTTGA
TTTTTTTTTTTTTTCCTTTTGCAGGCGTTGTTCCTTTGGCCACATACATGCGAATCTACA
AGAAGGGTGATATTGTAGACATCAAGGTAAGTTGATGGAGTGGAGGGAAGGGCACACGTG
TTAGGAATTGTGATTTAATTACTTGAAGTTAATAGCCCAGGATGGGGGAAAAGTAAAAGA
TACAGTTAAAAATAACCTTATTAGGAATTGAGAGCGCTGCCTCATGCCTTTGAGCCTAGC
TAGCACTCAGTGCAAAGGCAAGCAGATTTCTCTAGTTCAAGGCCAGATGAGGCTGTACAG
TTAGACCCCCATATGAAGATAATATTTGTTATTAAAGATGGCAGTGTTACGGAACCCCCC
GTGAAGGCCGTGTCCTTTGATGGGTCGTTGAACAGATTCTGTCGCTCTGGAACTTAATGA
TGATTGTCTGTTTGATTGCTTGATGCAATGTGAAAACCACATTTCACCGGCTCTGAGAGT
TCTTGAGCTGACCTTGAAAGGGAGCCTTGGTTAGTTACAAGGATTTGAAAAGAGGAATTT
CTGGAATAATACTTTTTCTGTTGACTAGGGAATGGGCACTGTTCAAAAAGGAATGCCCCA
TAAGTGCTACCACGGCAAAACCGGAAGAGTCTACAATGTCACCCAGCATGCCGTGGGCAT
CATTGTCAACAAGCAGGTTAAGTGAGTAGAGCGCCTTTCTTTGACTAAGTAGCTGGCCTC
ACCCCCCCTTTCACTTTGCCAATTGGACTTAATGTCTTCATTGGCCATTCAAGTGGGGCA
AAGGAAATAACCTTTTAAAACTCAGGCAAACTTAAGTGTTTGTCTTGTAACCTGTCAGGG
GAAACATTAACGTTGGGGAGGCCGGATTCTGTGAGTAGTCGGTGCTGGCTTTTATAGCAT
TAAAACTTCGTTACAGGCTTCCTTTGCCTGGTTTGGCTAAGTTACTGTGGTTTGGGGTCT
GTTTTTATCAGAAAAAGGAGCTTTAAAGTGCTCTCGAGGCCTCTTCCTTTGGGTGAGAAT
GATTGACATGTCACCATGTTGATCTTGGGGGAGTGTTAGTTAACAGCTGTCAGAACAGCG
TACATTGTACTGTGTTTCTGAGTGAAGCATTTAGAACTTACCGGTCTTTGCTCATTCCAG
GGGCAAAATTCTGGCCAAGAGGATCAATGTGCGGATTGAGCACATCAAGCACTCAAAGAG
CAGAGACAGCTTCCTGAAGCGGGTGAAGGAGAATGACCAGAAGAAAAAGGAAGCCAAAGA
GAAGGGCACCTGGGTGCAGCTGAAGCGCCAGGTGAGAGCTGCCTTGGCGGTGTTCACTCA
CTGTTAATCTTGAGGAACCCTTAGAACTTGGCTCACTTTGTTAATAAGCTTAAGAAGTGT
GTATTCATTATTTCCAAAAACCACTAAACTTCACTATAATTTCATTTTTTTTCTTACCAG
CCTGCGCCACCCAGAGAAGCACACTTTGTGAGGACTAATGGAAAAGAGCCTGAGCTGTTG
GAGCCCATTCCATACGAATTCATGGCCTAATGTACACAAAGAAATAAAATACCAGCACCA
GGACTGTGAAGTGTTTTCCTTAGACTGTAGTGTGGGGTTTGCTCATTGGCTTTCTTGTTC
AGATTTTACTAATTGTTCTAAATGATACAGCTTAGTGTGCAGAAAATATCCTCTTGATTG
GAAAATAGCCAAATATTTACAAAACAGGTATACTAGTTTGAAGAGGCTCTATATGGGGGG
AGGGGGTGCTGGAAAACATTAGTGGGTGACCAGTAATGGTGGTACAGCTCTAACTCCTAG
CACCAGGAGTCCGAGGCAGGGGGATCTTCAGGCTGCATGATGTGCATAGTAGCATGCTGG
TATTAGGGAGTGGGTATCTGTGGTTCCCACTTTGAAAATAACCAAAATTCTCCAAAGTGG
GCAGACCTAAGCCAGGAGAGGGCTGGCCACAGACATTTGGTACTGCTTGCTGAGAAAGCA
CTGATTGTTTTCCTAACCTAAAGATTATATATGGCCCACCATACCATCTTTGAAACAATG
TGTACTGGCCTTTGGTTCACCTTTCTTGTCTTTGAAGTTGTACTTGGTGGGTGCATTTAA
CCTTGCCACAGAGTGGGGAGGATAGAGTCTAATGGACCTTAAGTGGTCTCTGGTGGCCAT
GTCGGCAGTGCTTAGGTTGTAGCCCAGGGTTGGAGTCGGCAGTGACAAGCAAATAACTAT
ATTCTTGCTTGCTGTGGCAGCTATACAGAAATTTACGGTATAGGTAAGAGGGTTCTCTAG
AAGTACTACCTGTCTTAGTGAAAGAGATTGCTTGGTTAACATCCTGTTATGTAGTGGGGC
TACTTTTAAACTGTGTGAAGTCCCCATTAGCCACCTCCATAGGCAATGGAGCTAACATTC
TTGCTACAGTGGCCGCAGCTCATTAACACCTAATGATGTGTTTAACATGTGTCCACATGG
TGTGAATGTGGGTACGCATGTGCCCAGTATTCAGTTCACAGAATTGTCATCATCTTCCAT
CATGTCTTCAGTGAGGGACTCTGCAGATGCCCACCCCAGTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 2040..2118, 2304..2365, 2848..2960, 3420..3570, 3720..3841
2052..2118, 2304..2365, 2848..2960, 3420..3570, 3720..3806
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved