Mus_musculus Locus Rpl6
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl6
Mus_musculus
Rpl6
5
SNORA42
1477..1610
6434
GTCAGGTATACAGTGTCATTTTTCAAAGGATAGTAGCTTATTTAAAAATGTAATGAACA
AAAAAGTTTTATTTTAAATCTTATTTATTTTTTCCTATTTAATTTGTTTATTTTGTTTTG
GGGGCAGGGTTTGCTTGCATAGCCTTGGCTCTCCTAGAACTAGCTTTGTAGTTCAGGCTG
GCCTCAAACTCACAGAGATCTACCAGCCTCTGCCTTCCTAGTGCTGGGATTGAAGGGGTG
TGCCACCACTGTCAGACTTTTTTTTTTTAAAGATTTATTTATTTATTTATTATTTATGTA
TTTGGTTTTCAAAACAGGGTTTCTCTGCATAGCCCTGGCAAGATTTATTTATCTTATGTA
TATGAGTACACTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGTATGGGATCCCAT
TACAGATGGTTATGAGCCATCATGTGGTTGCTGGAAATTGAACTCAAAAAACTCTGGAAG
AGCAGCCAGTTCTCTTAACCACTGGGCCATCACTCCAACCCTAACCTTTAGTTTTTAGAA
GATAACTCTGGCCAGGCGTGGTGCAACACGCCTTTAATCCCAACACTTGGGCGGCAAAGG
CAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGCATGAGTTCCAGGACAGGCAG
GGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAGAAGAAGAAGGA
GGAGGAGGAGAAGAAGAAAACTCTGTAAAGTCCTTTCTTCCACCACATGAGTCGCAAGGC
TCAAAGTCTGTTCATCATTTTAGGAGAAAGCGCTTTTACTTGCTCAGCCATCTCAGCTGC
CCTTACCTATTAGGGTGGGGGTGGGGCCTGGGGGGACGTTCCCTAGGTGCATTGCCACGG
AGTAAAGAAAAACTACATTTCCCATGATGCCCCATACAGGAAGGAAGTGATCTTGGTCAC
CTCCCGTCATTGCTTATAGACCGGAAGCCGCTGCCTTAGTTCTCTTTCCCGTCTTGCAAG
GTAGGAATGGCGGGCGTCTGTGTGGCAGCGGCTTTCGGGACCCCAATCCTCGTCCATCCG
AAATTGGGGGACATCCGGGGATCACTACCCAGGGCCGCCTATGGTCGGGATCATTCGCCA
GATCTCTCGGGAGCTTCATTTCTGTCAGCGTGGGTTGGCGGGGGGCTAAGAACGAGCGTA
GCGCCCGAGATGGTCGCTGGGCCCTGCCGGCTGCCGTAACCTGGGGAGGGTTGGAGGGCC
TGTGTTGCGACTTGCGACCCTGCAGTGGGGGTTCCAGAACCTTCTGTTGAGCCTGTCTTG
GCCACGTTGGGCTTCGCGACTGAAGGTGGGGAACCGCGTCCCCGGAAGACGACCGGAGAG
CACCGCTGTCGGCTACTTTGCGGAGCTGGGGCCATCGTGGTGGCTTCGGGACCTAGGGCG
ACACCAGAGGGGGAGGTCTCGGGTGTTCCGTGCTGGTGCATGGGTTTGGATTTATGGCAG
GCCCGTTCCCCTGGGTCTGTCATAGTGTCCCGTGCTAGAGCAACCCGTGGCCCCGAACCA
TTGCCTGGCCTCTGCCTGTAGGCTGCTGGCACTGAAGTGGGTCGCACAGAAGAGCCTCGA
GATTCTGGGCTTCCTTGCCTGTGTAGACACTAGCAAAGATTGTCTTTGGTTTTCTGATTC
ACAAAAATGGAAGAATAAGATAAGGAACCACAAAAAAGTTTTTTAGCAAAAAAAAAAAAA
CAAAAAAACTAATAGTGCTAGATACTTAACCCTGTGTTTGGAAGGAAGAGGCATTGCAAG
CATCAGAGGATGGTTTTCATACTAGCTTGTTGACAAATGGTTGATGAAATGCCTTTATTG
TTTATATCCCTAGATGGCGGGTGAAAAAGCGCCTGATACAAAGGAGAAGAAACCTGCGGC
CAAGAAGGCTGGCAGTGATGCTGCTGCCTCCCGGCCCCGGGCCGCCAAAGTAGCCAAAAA
GGTTCACCCTAAGGGTAAAAAGCCCAAGAAGGCGAAGCCCCATTGCAGCCGAAACCCTGT
CCTGGTGAGAGGAATTGGCAGGTACTCCCGATCTGCTATGTACTCCAGGAAGGCCTTGTA
CAAAAGGAAATACTCGGCTGCCAAGACCAAGGTAGGAGAGGGAACGGATGGCCCACTATG
ATGCCTTATTCCTGCGTTTGAGGTCTGGCAGGATCCTGGATTGATGGGTTTGTCTTTGTA
GGTTGAGAAGAAGAAGAAAAAAGAGAAGGTCCTTGCTACTGTCACCAAAACAGTTGGTGG
GGACAAGAACGGTGGCACCCGGGTGGTGAAGCTTCGAAAAATGGTGAGATCTAGTTTGGG
TTGCTTTCCTTGGGGTTAGGGTTGAGGCTTGTCTGAAAGAGGCTATGTCAGTCAAGTCTA
GTTGGGATAAGCTCTCAGGCTGGGGGTGTAGCTCATAGTGGGACCAGCACACTGGGGTTC
TGGCTACTCCATTGCTGGCAAGTGGAAGGTGGGTATTTATCAAACTTGTGGTATTGATGT
CTAGTTTTCCCTCTTGAAGAAAGTGGGTGTGTGCCTTCTGCCAAGGTAGAAGAGGTATGA
TGCGCTTTGTACCTTTGCCTCGGGTAGCCTGGTCTGATCTGAAACTCCCTTCTGAGCCAC
CTTCCCCATATTTGGCTGTGACCTTAACTCCTAAGAAGTGTGTTAGAGTTCCAAGCCCCA
AGGAAAGCTTGGGAATGAGTGGAGAGATGCCTCGGGGTAAGGGGACAGTGCTGTTCCCAG
CCTCTGCTACAGGCTCTTCCCAGCCACCTGGAACTCCCACTCCCAAGGATAACTCAGTGG
CACATGTACTCATGGGCATACCCAGGGACACATGCAAACCGCATTCCTTTAATCCCAGCC
CTCGAGGGGCAAAGGCAGGCTGATCTCAATGTTCTAAGCCACCCAGGGCTACAGAGAAAC
CCTGTCTCAGAAAAGCAAAACAAGCCAAACACTTTTTAAAAAGGTTAGAGTGTCTGTCTC
CAGTGTGCCAGAGGTTCCTTTCTGTGTTGTCAGTGGGGCTTGACTCTTGGGGTTTTCAAG
GCTGTGTCTCTGAATGCAGCTCTGGTGGGCTGAGCAGATTGCTCAATGGTGTGTGGTGCC
GGTGCTCTCTCCAGCCTAGGTATTATCCCACCGAAGATGTTCCTCGGAAGCTGCTGAGCC
ACGGCAAGAAGCCCTTCAGCCAGCACGTGAGAAGGCTACGCTCCAGCATCACTCCCGGAA
CTGTCCTGATCATCCTCACTGGGCGCCACAGGGGCAAGGTGAGGAGTGTCCCCAGGGCCT
GGCATGGGGGAGCAGCAGATCCTGGTCCTCGCATGCCTGGTGCATCCTGCTTTTTGATGT
ACCATAAATATTTTCTTGTTCTCTGTAACAAGTTTAACCCCTTAGTAAATGCTGTGTTTT
GGTGTGGTTACGAATGCCATAGAGTCTGTTTCTGTCCCACCAGTGCTAGGACAAAAGGCG
TGTATCACCTCACCTTTCCTTTTGACAAGGTCTCATGTAGCCCAGTCTAGACTTGAAGTG
CCAGATGTATTCATACTTGTACTTTGGTTAATTCTGGGTGAGGTTTAATTGTCATTTCTC
TGTTTGACTTCCAGAGAGTGGTTTTCCTGAAGCAGCTGGACAGTGGCTTGCTGCTTGTGA
CTGGTAAGAAAATCCTTGGTCTTTTATGTTTTGACAGGATGTCACAGCCCAAGATAACCT
TGGACTCTTTTCCCTTCTCAGATACTATTACTAATGCTACATGATAAATGGTAGTTAGAT
TAATGTACAGTGACGTTCCCATCTAACACAGCTTGCTTAAGTTTAGCGGATATGTTCTTC
TTGAGTGGAATACTTTTTTTGTTTTGTTTTGTTTTGGTTTTTTGAGACAGGGTTTCTCTG
TGTAGCCCTAGCTGTCCTGGAACTAACTGTAGACCAGGCTGGCCTCAAACGCAGAAATCC
GCCTGCCTCTGCCTCTGGAGTGCTAGGATTAAAGGCGTGCACCACCCTACCTGGCTGGAG
TGGACTATACTTCTTAAGTCATCCCTCCTGGTTTTATATAGGATGACCCCCTTTTCTGGC
CAGATTTCCTTGTAAACCTGGGTATGGTATGGCTTCATGGGGACCCAAGCATTTTTATTA
AGGACCAAGGTCACAGCACCACCCTTGGCATTGCAGGAGCATGTCACCTGCACTGTGATA
GGAGACAGGTCTTGTGTAGACCCGGCTGGTCTCAGATCTGCAGGACTCTGTACCCTGAAA
TTTAGGTTCATCCCCACCCCCTTTCAGTTTTGGAGGTCAGAGGTCAACTAAGGCCTTCCT
GTCTTGTTGACTGACCCTATTTTATTTTTCTGCAGCAGTCAAGGGTTTAATTTGAGCAAG
CATGTTTTTTACACTGGCGTGATGTGCTTGAGAGCCTGACCTGTGTGATAAAGGAGGAAA
GGGGGCTGTGCAAGTTGTCCCCTCGCCTCCACTGGTGCTGCAGTGTGGCACACAGATGTA
CTGTGCCTACGCAGTGTCCCAAACCCAGCACTGAGGCGGATCTCAAGGACAGGTGGTTCA
GCCAGCCTCTGTAAAAGATCCTCTTCTCACCTGGGTCCCTTGAAGGGGATGGAGTGGGTG
GCATGGGTTTTTCTCCCCAAGATGAGTTGTGAGCACTCTGGGTACCAGGAATGTAAAAAG
GGTCTTATCTCTGCCCCATCCAATTAACGTTTTTGTTAGAGACAAATCCAAAGGACCAGA
CTGGCCTCAAACTCGAGATCTACCTTCCTCTCTGCTGAAATTACAGGCGTGTGCTACCAT
GCCTGGACCAAATCTTAACTGTTTGATGTTCTTATTCAAATTTGTGTTTTTCCTATAGGG
CCTCTTGTCATCAACAGAGTTCCTCTGCGCAGAACACACCAGAAGTTTGTCATTGCCACC
TCTACAAAAGTTGATATCAGCGATGTTAAAATCCCCAAACACCTGACTGACGCTTACTTC
AAGAAGAAGCAGCTGCGCAAGCCCAGGCATCAGGAGGGCGAGATCTTCGACACAGAGAAG
GAGGTGAGCTCTTGTGTGAACTGGCCTGCTCTCCAGTTGGGAATGGGTGGAGGAGGCTAC
TTAGTGTTAAACCCAGGAAGCGGTTCTAGTGTGGCAGTCTGAGTTGAGATGGTTGACTTA
GAGTAGGCAAGCTCCAAGGAAAGGTTGTGAGTAGGTGGTGGGGCTGTTCCTGCCGTCCTG
ATTCTTAACGTTTCCTTTTCTCTGTTTAGAAATACGAGATTACAGAGCAGCGAAAGGCTG
ACCAGAAAGCTGTGGATTTGCAGATTTTGCCAAAGATTAAAGCTGTTCCTCAGCTCCAGG
GCTACCTGCGCTCTCAGTTTTCCCTGACAAACGGGATGTATCCTCACAAACTGGTCTTCT
AAATTGTTAACCTAATTAAACAGCTTCATAGGTTCTTTTGGTGTCCTTTTTGTGTGTTGT
GTGTGCACATGTTTGTTGGGTGGGTGTTTTGCTGGTGTCTTTTCCTCTGTGTCTTCCTCT
GGCCCTTTCTGGAAAGACCTGCTTAATCTGAAGCATGTGAGCTAGGCTAGTCCACTGGGT
CCTGCTCTCTGCCCATCCCCAGCTGGCTTTGGATTAGAGGCACATACACTGCCATGGCTG
CCTTTTACTGTGGCTGTGGTTTTGCCCTTTTTTTTTAAGCAAATAGAAAATGCTGCTGAC
TATACTGGATTTTTTTGACTATAGACTCAAGTCTTTCTCAGGGTGAGAATTTAAGCACAA
AAACCATCTCCAAGGTTCACAAACCTCTTGAGAGTGGGGTTGCATGGGAACAGTGTGTGC
TGTGGGCCTGATCTTTGCTCAAAGCTTTGTTACCAGTATTGGCTTAGGATTTAATGAGTG
TCTTGCTGTGTGGCATTTTCTTGCATCCTCAACTTAAAAACAATGGACTGCTGCCTTGTG
AACAGATCAAAACTAAAGTGTGTGAAAGATGACAAGGGTCTTTACAAACCACGTCACCTA
GTCATTGCAGTTGTGGGTTTCAGGTCTCGGTGGACAGAATGCACTCATCCTCAGCCCGGT
TCTTAGCCAGACAACACATGTACTATATAGGTAAATGGTATTTGTGGGTACATGCTATGA
CATTCATGGAAAGCATTTCTTAAGCTGTGTCTAGAGGTCAAGAGAGGGCATTGAACCCCA
CCCCCAACACAACCACAATTAGGGTTATCTGTGAACCAATACGAATATTCTATGTGACAA
GTACCTACCTCTTCCGAAAAGCCATGCCAATAGTGTGCTGTATTGTGAGGTCTTGCTTTG
CTGGGTTAATGACTTCTGACTAGTAGGGATCCTAGATGACATTAGATATGTCTGTTTTTA
TGCCTTGGCAAGTGCCAGAGTGCCCCATTTTTACATAGTAATGATTCCTTGAGTGGGAGC
TTTGCTTTGGGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1019, 1873..2130, 2221..2322, 3134..3277, 3614..3662, 4858..5042, 5249..5434
1873..2130, 2221..2322, 3134..3277, 3614..3662, 4858..5042, 5249..5398
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved