Mus_musculus Locus Rpl5
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl5
Mus_musculus
Rpl5
5
SNORD21, SNORA66, SNORA66
4984..5077, 5606..5737, 7774..7905
9477
ctttcacgtgtttaaataattgtttgtatgcatttcttttccttcaggcagcccaggct
ggcttccaattcactaggtagcctaggctagccttgcactttctgattctttttcctctc
ccttctaagtactgaggctgcaattcttagctgcacacccagtcctaaaaagaaacttct
tgaggaaggggactaagagtgatggaggaggcggcgctcataatgtcaggaattctgggg
acaatggaagcataaaggcaacaggagagtgcagtgggttttgttttgttttcaccatgt
aacaggtaactaagaattgactggaggtcagcactctgagaagtgctggagaatgaaaag
tatgcttgaagcagatgtcaagatgctatgcaaaggcagaagagtctcttctaactcaaa
cttgaggctctgaggctgagcttcccggcggccctgtgtgctgggaattccgaaatatat
attccagaagtgagtcaagtcatggagaaggcaagatttcagcataggcaaattcatgta
tttaacttaatttttaccccctcctgcttagaaaaataattatataagtgtggtgtgtgt
gcgtgcatgccgagcgtgtttttaaaaatgtcctcctgcccggtagtggtggcacacgcc
tttaatcccagcacttgggaggcagaggcaggctgatttctgagttcgagaccagcctgg
tctacagagtgagttccaggacagccagggtcacacagagaaaccctatctcgaaaaacc
accccccccccaaaaaaaaaaaaaaaaaagtcctcgcaaaaagcctctatttccctttct
catcgcccatcctccatgctcgttgagaggaggaagatgacattcatcctcctaccggca
gggggcgatagcccgcgcatcttgaggcctacagccactctttctcacgtcgcttgcgtg
ctggtggtgctacatactgcgcatgcgtacgtgactccggtctttttcccccttagcgcg
gccgactctgcaggtctgcgtggagccgcggttgcgggtctctattccgcaggatggtga
gtgggcatctgggtctcaggcccgtgcgtgcaccggggtgccccctcctctcgcggatgc
ccgctcggggtcggctcgtgcgacccggggggcagatggcattcgattcccggctctgcg
cccgccgttccagcgtggcctaatggctgccgggtgccagccgggggaggggccgcggcg
gagggtgctcgggacgaggcttccgagtccggctgccagccgcagttgtctccggggtcg
tcaggaggccgtgccacggaagcccgaatccctcggcctcgcacagagccctgaagccgg
gagtgtctgtcagtggaggccgtggcgctgctgcgtcccggaagggatgtggcggcccct
ggctcttcctggccagagtctggccctgttttcagagatttgctgagatcggacttgaga
ggtggggtgcagctcttcatttgcgaggagtaattgtagatcgtactctgccatttgagc
ccggtttaggcagggaggaagtgagcgccgagtggttgaactttctcggtgaggtgtgca
gttgtcggcacagattggctccggtgtaggtgatacatcccggcggtttggcgtagggat
cgatcagtggtacaggaattgaaagattgtttaaaggcagtacgaaaatgtctttgtacc
tgcaagttgtagtaaggagcctgcagttgtggatggagcgacttgggtcggtgccctatt
ccgcccagccatctttacgtgttttctgaggcttagttaggtgtgtttggcgaagagaac
cagtgcaacagcagttctccatctggttcttaacccatctgtcagatatttgtattaacg
atgaataactacaagattaaattaacgaagcagcaacgagatttatggtttggggaaggg
tcaccacagcatgaggaactaaccttattaaaggttgagcactgcacaacagcgattctt
gtttccggtcagcttagaaacatgctatagaagttgacacttgtaataatttgcttttga
aacttgggcatgattttgttacatagttaaataaaaaaatacagaccaaaacccaggtgg
ttcttgcctattaattcggcgctcagaaactaccaaatgctaggtcatgttgggctacat
agttggcctgtatcaaaagaaaaaagtcatgggacgaaacaattagcaaagccctgataa
ttttttttttcctttaaaggggtttgtgaaagttgtcaagaataaggcctactttaaaag
ataccaagtgagatttcgaaggcggcgaggtatgaactttttctgttttagtttctgaag
actgtttcaaggtggaaccttccctggttaaatttttttttccccttgcagagggtaaaa
ctgactactatgctcgaaaacgattggtgatccaggacaagaataagtacaacacaccca
aatataggatgatagttcgtgtaactaacagagatatcatctgccaggtgagttatgtcc
tagacttgagtagtgtggtcagacgcatcaactctaacttttgggagagactattttctt
gtgttagtagatttcagtggcgggtggggggggtgggggtggggggaaggtttggaaatc
ctggctttgcttaatttccattatggaatttgagaggaggactgggaaatctgttgatat
gaatagtcttccaattaccttcatctgtcacgcattaactcctggtgcttactttatggg
cttgtgtgccattttactgatttaaaaaggctggtaatagggtggtaggactcttgttgc
caggcagggttgctcatctgtcatcccagcatgacaagctatttctatttactgtttgaa
ataggttttaaaatacacaaaaatgtcttccactttgaaagccctttaaaaatggcagtc
cctgtattcagggcttttacaataaaaatttgctggtcaggagataggtgcacttgcctt
ttgtgactttgttaactgaaggtggggttgtctggtgttctgataattaaggatgaagtg
tctaagacttggttaaatttagctcaaaagatacttttaagtaagtgagacctgactttg
gtggtggtggatctttatttagttaaccttggctgttgcctgtagaccaggctggccttg
aatttaaagctctgcctgcctctacctccccagggctaggattaaaggtgcccttttttg
agatggggtcctactgtatgaccctggctgacctgtaattctttgtagaccaggccagcc
ttgaaagaatcttgcaatatagccatgagctcaggatctagtctgagatcatctcctgcc
cagtttgttgacttctaaaggcacctatgatttcaccaactcacccaccataaataatgc
cttcagtatttagaaagagctattataattgagttctaacatgccatatgtattttaacc
atacttttccccctaaaccaccatgtagttgatgcccatacagattagtcttcaatgagt
tgtctcttctcatcacagcttgttaagaggcacttaggtgggacaggtaccaaagcattg
atagcaacaagttaataacctgacttttctcactgcagattgcatatgcccgtatagaag
gggatatgatcgtctgtgcagcatatgcacatgaacttccaaaatatggtgtgaaagttg
gcctgacaaattatgctgcagcctattgcactggcctgctgctggcccgcagggtatgta
tataatatcttcaataaggtgcctgctatttgcttgtggcttgcaaagtcatcagcaggg
aacatggttttatcagtctgggaagttgtcgtcttgggatattgtagacaagtcgtttag
ataggcagcaaagcccaggtacctatataaagactgaagaaatgtaggagtcaaattgtg
agattgttgtaacatgaagtacatttagtggcttgactgtactgagactgtttatgttga
cttctctgttcatagcttctgaataggtttggcatggacaagatctatgaaggccaagtg
gaggtgaatggaggtgaatacaatgtggaaagcattgacggtcagcctggtgccttcact
tgctatctggatgcaggtcttgcccgaactacaactggcaataaagtttttggggccctg
aagggagctgtggatggaggcttgtctatccctcataggtaatagatagtatttaagatt
tctgtgatgactccactatttcctactggttactcactgactagcagtcattcaatgcct
gttctgtgtagttactgtacaaggaacctgtactagagaactcagggtgatgattgtcca
gcctctgtctcccgagtgctaggattaaagttgtgtagcactacccccggtcctgtgcat
ttgccagtcaaagttcattttttgggttaggggaaaatgaggcttctagaataaaacatt
tagaggcaaaagcctgagatttaaaagcttttcagtcattaagattgctgaatactagag
atgaagtaaattaatttgtaattcctcagagttaatgcatttttttgttgtaactagcat
attgactaacttaaattttcataaatttctttttgaacatcctcattgattgtgatttag
acacgtcactaactcattctagctaccactgagaaataaatacttaagggatgacttttg
aactgccacctgtgccacagggcaaggaaacctgtgaaagaaagcactggtggctctggg
ttcttgggatcaacaggctggctagagcccaggagttctgaggcaccctgggcagagcag
actctaggaaggtgaaaagcaagtgtgtttatggtcgtttatctgtgcaattcagagatg
agctgccaatgatgacaccacactaactgagcagttagtagttggtcctttgattgcatg
tgatgtaatcattgtttcaagacgggactgaaggcggctcctgaagtgaattcctgggag
tgttgtaatttcttgtctgtatactgacataaaattttcatcttagtaccaaacgattcc
ctggttatgactctgaaagcaaggagttcaatgcagaggtacatcggaagcacatcatgg
gtcagaatgtggcagactacatgcgctacctaatggaggaagatgaagatgcgtataaga
aacagttctctcagtacatcaagaacaacgtaactccagacatggtaaaaatttacccga
acatgatgttcacttacagaaactgcttatttcagtggttgtagtgttaacattgatttt
attttgcaaactggaaggttggatgtggctttgtgggtagatacagataggctactaagc
agctgctccttttgagtgaagttagtatattggtcaggcgggaagaggatttttagatgc
taataaatatgggcttctagcatttaaagtctccctgtagtaggaatggttcctgcattg
cctgctgtatcttgctggtcagaaaactgcaaactcgatcactagctctgcataatgtgg
cagcagctaagggaaccaggtttgctagagtaattgtggcgacagcaatgtaccaacctc
agaagctactgaggtgcccattctgtcacagtacagcctttttttttttttttttttttt
ttttttttttttttcctttttgaatggctgctttataagagacttaactttttgatttgt
gcaataaggttttgctgaggagccttggctatcctggaactcaacttcgtagaccaggct
ggccttggaaatcagagatccgtctgcttgtgctgggattaaagttgtgcgccgccacca
ccacccagctttgggggttgaggttggggaggacaagcctcacttctcctggatttgtct
agggacttgatattcaaccagggtcaccatggaatttaagacagtcctgaccctttaatc
ccagcacttgggaggcagaggcaggcggatttctgagtttgaggccagcctggtctacag
agttgagtcccaggacagccagggctatacagagaaaccctgtctggaaaacccaaaaaa
aaaaaaaaaaaaaaaaagaccgtctgacttaaaggggtgagttaccataccctactgcag
tttagagtttattgaaatcctctggggctctaccagttgtttgtaaaagtaggggttggg
gaagtaattgagtttgatactggaatctatcaactctaaagtctcctctctgaagtatag
agtggaaagcactttctgtggtctgtgcgctctcctctggacataatcttacatgagact
cagttcatggtttcctgtgtgcacttcacttctttcttgtctttctgggtcttgtactga
cttcctcatgctgtgcttgctcagcttgaggctcagggttttctatgggataaagcttct
gtgttcagcctctgagcttccatcctgtagttgcttttacttatcaggagtgttgtgggt
agctgctgaaatctcctgcagacttaatgtttctcagcagagtgagtgagtgagtccatg
gcctcatctacatagtgaagctgtttgaaagaactgggtggtttaacttgcagttgtcag
gttgtatgatagagggttgaagaacattctgtctcctgagtactgggatcactggcttga
gagagtgaggaaattattttctctttgtcacctcttccatgttgaaatgaattagtttag
aaagctggattacagtcactttaataagagcttgcagggtatcaagctcttggcattcct
gttcttgagcacctattatacttcaggggtttatagccttggatttaatttgtttttgtt
tttcgagacagggtttctctgtgtagccctggctatcctggaactcactctgtagaccag
gctggcctcgaactcagaaatccgcctgcctctgcctccctgggattaaaggcgtacacc
accacattgaatttaattttttaaaacaaacttgaatcaaaggttccagtaatgaaatct
aataagatagctaccacgtactaaaattggcaacggtatagtatgtctctggtgctggct
taaaaggcctgtcacataagagggaatataaatttggatatttgggatgataaaaaaatt
gttacctagtttggtaggataaccccctcctcatgcccttgctctcacttgttagtgtgt
ctttatccctgtatagttcacatcttttaggtgtacaccttcttttgaaagaatttaggt
gaggcagtagactacagagtatggtatagttgtacaaaaatgggcttgtagttctcagga
aagcatgcaggtgttcatcctaaacagtgagatgtaaggataagggtgggctgcacttgg
ggatataaggaggtaatattggcttagttaggatcctttgagaactgaatgcaggtggta
ctgtacctttagggcacatgaaatgaaggcaaatactgtttgctttgctttcttccagat
ggaggagatgtataagaaagctcatgctgctatccgagagaatccagtctatgagaagaa
gcccaagagagaagtgaagaagaagaggtgggtggtttacaattctctaggaaagaaacc
cgctgcatcttgctggtcagatttctgtgcacttgagcaaactcgatcactagctctgca
taatgtggcagcagctgagggaaccaggtttgctagagtaattgtggtgacagcaatgtg
ccaacctcagaagctactgaggtgcccattctgttacagtacagtcctgcatggtttctt
tttagctacctatagagtaacctttctttgcctgcctgaattcataacatttctgcctct
acctgacaatgtgaatactgggcttgtagtgtgagccatcatgctcagctgagatagact
tgagtttgatggcgtaaacaatgagaatatagccattgcagttgagtacccggattagaa
cttaatgtgtgtactcaggttttgaggcatgacaattgcaacaagttcaaagccaactaa
aggatatataggaaaacctataatatacacacatgcatacacacacacacacacacatct
tcagataatgagattttcaatctatccaattacaaaggttttgtcattttttttttcagc
tgcacttgagagatattcctgtcttattccttactttgttttgtaggtggaatcgtccca
aaatgtctcttgcccagaagaaagatcgggttgctcaaaagaaggcaagcttcctcagag
ctcaggaaagggctgctgaaagctaaagcagttttctatgaagattttttcataaagaca
ataaacatattgatcaagcagctttttctgtgttaagctgttattaatgagactatagga
aatagtgtgaaattacaaaagcaaagaagtagatagttatttaattaattaaattaattt
taccttttgtgttgcaccataacctaccactggtgggattaagggcaagtattaccatgc
ctagctgagagtctttctccaggaaaaaccagcttacatgggttcctgcaaatctcatga
gtgtttcttgggtttctagtcttcctgggaggtgtccttatctttcagattttcagatct
ggtaattagcatgatcatcaggacatttattacaaacaaattgattagtgggaagaaagt
atctcaaggtcaatcttggaagtgaacaactggtgctaatccatggctttaaagatttga
gaacaacggtgaaatttggtttgaggagaagggggtgtctaggacgtttcatttttatgg
tacatgccagacatgaatgtacataggaaaataacttgaaagggtcaaatattaaacctt
gaatatcaggttcacttgggaaagcattaggtgcttatgcctcttagtaaatagcccttc
atcccagaaggagcaagaattgtcttcctgacttaatccagtcttagctgaggtgctgtg
catctttatcatctttgccttgcctcacagtgtcaggctctgtggtactggggctacaca
ggtcaggtaaacagttaactgcttacctacatccccagcaaagataatgtgacgatacta
agatgaacctatcagagcttaaagataatgagtttcagtcacagtgataactgcatgcta
acttcagcatgtagaatatatgccgaagctaaaagccattccacagttgactccatctga
agttaaagtgtgtaagtacacagtaaatcatgctatattaactgaactttttaataaatg
agtcatttgaatttacctgtgtggcattcttaatttgtgttaatgtgcaaagttttac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 2299..2368, 2451..2566, 3698..3832, 4095..4297, 5146..5323, 7618..7706, 8326..8478
1073..1075, 2299..2368, 2451..2566, 3698..3832, 4095..4297, 5146..5323, 7618..7706, 8326..8425
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved