Mus_musculus Locus Rplp2
snOPY snoRNA Orthological Gene Database
Mus_musculus Rplp2
Mus_musculus
Rplp2
7
SNORA52
2153..2289
5699
AACAGGGTCTCTCTGTGTAGCCTTGGCTATCCTAAACCTGCCATTCCCTCCCAAGTACT
GGAATTAAAGGCATGCAACACCCTCTCCCAACGAGGCAAAGGTTTACTTTTTTTCTTTTA
AATATTTACCTATTTGTTTTACATGAGTGTTCTGTCTTGATACACACCAGAAGAGGGAAT
CAAATCCCATCACAGATGGTTGTGACATGTGGGTGCTGGGAATTGAACTCAGGACCTCTG
GAAGAGCAGTCAACGTCCAAACTATTAACCCCTGAGCCATCTCTCCAGTCAAAAAGCTTT
TGATCCCAACACTCTGGAGGCAGAGGCAGGCGATCTCGTGAGTTCTTGGCCAACCTGGTC
TACATAGAGGTCCAGGATACCCAAGAGTATATAGAGAAACCTGTCTCAAAAGAAAAAAAA
AAAAGGAGGATGTTTCTAGATATGGCCGTAATCACTAGGACCCAGAAAGCTCGCCCAACT
TTTCCAAACCAGCTGAACTTGGGAGCCATCAGCCCCAGCCCAACTTAGGACCTCTGTTGC
CCAAGAACAGGAAGGACCCATAGCACCACAGTTTGAACCAATAGCCGCCCACCCAGCCCA
CGTGCAACAAGAAAAAGCTAGAAGGGAGCACACTTCCGGTATGAAGGTCTTACAGTGAAG
CGTCATGGGATTTGTAGTTCGCCTTAATAAGACCAGGGCGGGGCCTTCGCGCTGCATTTT
GGGAGCTGTGGAGCCGAGTAGCATGCTGGGGACGCGAGGCGTTAAAGGGGTTTGAACGCT
ACGCCCGTGCCCGCATGGATTTCGGGAGACTCTCGTCCATGTTGCAGAGGCCCCTGGCAC
TTGAAAAATCCCTCGTTTTTGTTGTGGGGAAGACATGACAGGGAAATGTCTTCCTTCCGG
TGCACCCTTTTCGTCAATGGGAGGCGTCCCCGTGCGCCGCCGTACGCGTCCCGGGGGCTT
CTGGGTAGCGGTTTACCCCCGCCCACTGCGTCAGCGTCTTCCTTTCGCCGCCGGACGCCG
CCGAGGTCGCACGCGTGAGGTCTGTCCCCCGCAGCCGAGTGAGTAGCCTGGCCGCCTGGG
CCGCGAACAGTGGTGGGGACTGCGGGGTTGGATGACGGCCGGGAGGCGAGGGTGGCGCAG
CATTCTGTGACCGGAGGCCTGGCGCCTCACGTGGCCTCACTTGCTGCTTAAAATGGAGGG
GGAAGCAGAAGGCCTCTCGGATAACCTCACCACTGTACCCACTCCCTGCCCCATTTAGCA
TGCGCTACGTCGCCTCTTACCTGCTGGCCGCCCTCGGGGGCAACTCCTCTCCTAGCGCCA
AAGACATCAAGAAAATACTAGACAGCGTGGGCATCGAAGCGGACGATGATCGGCTCAACA
AGGTAGCATGCTGCTTGCTTGGACCCGCTGGATCCAAATGTCTACCAGCGGCGGTCCTTA
TCCTATTATGTCCGGATTTTACTTTTAAGAAAAATTGTAGATAACCTGTTGAAAAGGATG
GATGGAGGAGGCCTACACCCATCTTAGTCATAGTTTTCTCTTTAGTCCTTGTGCAATCGA
AGAAGTCAGTCGTGATAATCGTGCTTTTATAGAAGTTTAATACAACTCATGTTGTGTGAT
CTTATTTTTTGAGACAAGGCCTCACCGTGTAGCTCTGGCTAACCTGGAACTCACTGTGTA
AACCAGTTTTCTAACTTTTTTTTTTTTAAACTAGCTTTGCAGTAAAGGATGTATGTGTGT
AGATGCCAACAGAGGCATCTGTGTCTCCTTGGACCTATAGTGCTGGGACTCTAGGATATG
TTAGAGTCCAAGTCTTTAGCAGTGGAGCTATCTCATCGCCCCTTAAGATTCTTCTAGAAA
GGGTTCCCACTCCACCCACCTAGGTTGTACATAGAACCTAAACTTCACAGAACGGTAGAA
TTTTAGTATCTAAAACTTCCTTTGCCAAAATCATTGTTGAGAAGACCCAGCACTATCTCA
TAGGTAGTTCCTGGGAGTTGAGAGCAGGTCCAGTATCTCAGGAGACCTTCCCCGTGCCTT
GCATTGCTGACTGCTAGCTGTGGTTGTCTACCCCAGGTCATCAGTGAGCTGAATGGAAAG
AACATTGAGGATGTCATCGCTCAGGGTGAGTTCCTGGGAAGTTGGCCTGTTTGTGGTCCA
TCCTAATACCTGCTGGTCAGCCAGTGATCTGCCAGGCTTCGCTTGTGGACCAGAGCATCC
TAGAAACACTGCCAGAGTTGTGCAAGGCCTTTTCATTTTAGGCTTGTGCCTGCAGCGCTT
CAGAACACCCTCAGAAACTGGCAATGGGGTCACTTTATGGTTTCTACGAGGATGTGTGAA
AACCTTTCCTTTGAGGAGGGACTGGGGATGCTAAAAATTGGTGTTCTCTCTCTTTCCTTC
CTTTCTTCTTTTCTCTTTCTTTCTCTCTCGGTTTTTTGAGACAGGATTTCTCTGTGTAGC
TGGCTGTCCTGGAACTGACCAGGCTGGCCTTGAACTCAAATCTCCCTGCCTCTGCCTCCC
TAGTGCTGGGATTAAAGGTGTGTGCCACCAAGCCCTGCCACAGGTTCCTTCTTAACTAAG
GCATACAGATTTCTGGCACCACCGGACTAGTACTTATTTGCAATCAGCCTGGGGCACCCT
CATGGTAAAATGATTGTTCAATTTTTATTTATTTTTTTTTGCCTTGTTGTTTTTGTTTTT
TTGAGACAGGGTTTCTCTGCCTCCCGAGTGCTGGTATCAAGGGCGTACGCCACCACGCTC
GGCTGTTTGTTCAATTTTAAGATTTCTAAATAACTAAAAGTAAGAACCCATGTGGCCTGT
AAACCCACTTTGTAGACCATGATGGCCTTAAATTCACAGGCTTCTGCCTCCTGGCTGCTG
AAATTAAAAGTGTGCACCACCAAGCTGAGCTTGTGTGTGTTTGTTTGTTTGTTTTTGTGG
TTTCTCCTTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCATTGAAC
TCAGAAATCCGCCTGCCTCTGCCTCTGTCCTGAGTGCTGGGATTAAAGGCATTTGCCACC
ACGCCTGGCTTGAACTTTTTTTTTTTAATTAGGTATTTTCCTCATTTACATATCAAATAC
TTTCCCAAAAGTCCCCCATAAACCACACACACAGACACACACACTCCTACTTTTTGGCCC
TGGCATTCCCCTGTACTGAGGCATATAAAGTTTGCAAGACTAAGGGGCCTCTCTTCCCAA
TGATGGCCTACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACAAGCTCTGGGGGG
TACTTGTTAGTTCATATTGTTGTTCCACCTATAGGGTTGCAGACCCCTTTAGCTCTTTAG
GTATTTTCTCTAGCTCCTCCATTGGGGGCTCTGTGTTCCATCCAATAGCTGACTGTGAGC
ATCCACTTATGTGTTTGCCAGGCACCAGCATAGCCTCACAAGAAACAACTATATCAGGGT
CCTTTCAGCAAAATCTTGCTGGTGTATGCAGTGGTGTCAGCATTAGGAGGCTGATTATGG
GATGGATCCCCGGTGTGGCAGTCTCTAGATGGTCCATCCTTTTGTCTCAGCTCCAAACTT
TGTCTCTGTAACTCCTTCCATGGGTGTTTTGTTCCCAATCCCAAAAAGGGGTAGTGTCCA
GAACTTGTTTTAAAATGTACTTGGGGGCAGGGTTTATCTGAATAGCCCTGGCTGTCCTGG
AACTCATTGTATAAGGTCAGGTCAGGTTGGCCTCAAACTCATAATCTACCCGCCTCTTCC
TTCTAAGTGCTGGGTTATAGATGTGTCTCACCACCTCCCAGCTTATTTTGTTCCTGTGAT
TTTTAAAGTTTTTGAGACAGCAGTAAAGACAAGGTGTCTCTGTTTAGCCCATGCTGGCAT
TGAACTCGGATCCCCTACTGGGACTAAAGACATGCCTAGCTTGTCCATCTTGTTTTTTTT
TTTTTTTTTTCTTTTTTCTTTGAGACTGGGTTTCTCTGAGTAGCCTTGGCTGTCCTGAAA
CTCTGTAGACCAGGCTGGCCTCGAACTCAAGAGATCCGCCTGCCTCTGCCTCCCAAGTGC
TGGGATCAAAGGCGTGTGCCACCACGCCCAGCACATCTTGTTCTTAAGGTGGAGGTCAGA
GTGGTGCTAATTCCAGTTTCTTTTCTTTAGTGTATCAGAATGTGGGGAAAGAAGTCTTCA
ATGGTATTAGATGTTCCTAGATGTATGCAAAGCTGCTTTGTGTTTGGAGTGAAAGCAGGT
GGCAGTGGTTTTAAGTGAGCAGTCGTCCTGCTGGTGTGATAACTTCCCTCACAGGGTCTG
GGTTCTGGTCTCATGTTCTTTCTATTTTGTGTAGGTGTTGGCAAGCTGGCCAGTGTGCCT
GCTGGTGGGGCTGTGGCTGTTTCTGCTGCCCCTGGCTCTGCAGCACCTGCTGCTGGTTCT
GCCCCCGCTGCAGGTAAATGGAGGTCTGATGAGTGAGTGGGTGGTAAAGGGGGTTGGTAC
TCAAGGTTTATTGTTGCTTGGGGCTCCTGGGACAACCTAGATGAATTCTTGGGGCAGTGC
TTACTATGGTGTTCCCCCACAGCAGAGGAGAAGAAAGATGAGAAGAAGGAGGAGTCCGAG
GAGTCGGATGACGACATGGGATTTGGCTTGTTTGATTAAATTCCTGCTCCCCTGCAAATA
AAGTCTTTTTATGTATCTTGAGTGGCCTTTAAACATTTTGTCAACATGCGACATGCTGTG
TCTTCAGCCTAGGCTCCACCCAGAGTTGGGTCAGTGGGGGAAAGAGGATCCTTAGGCCCC
TTTACTTAGTAGGGCCTTGGCTTTAGACAACTGTCAGGCCCTGTGTGGTGTTTCCTTGCA
GCTTTTGTTAAATATTCTGGGAAAACAAGTTATGGGAAATATGAGTGAGCCTGAATTGAA
AAAAAATTTTTTTTTGAGTAGCACTGCTCTGCTGTAAGAGTGGTTCATAGGTCACTATTC
CACTTAGCTTGACAGTGAGGGTGTCCCCAAGTTTCCCTATAAGGATTGAGGTGTCAAGGT
ACAGATAACTTTTCAGAGTGTTAGCTTTCTAATGGCTGGTTCTCTACATTTTGCATTTAT
AAGTACATTATAGCTGTCCTCGGACACACTAGAAGAGGGCATCAGATCTCATTATGGATG
GTTGTGAGCCACCATATGGTTGCGGGAATTTGAACTCAGGACCTTTGGAAGAGCAGTCAG
TGTTCTTACTCACCTGGTCTGTCAGTCTTTTAGGTAGACAGCTGAGTGTTACACAGAGGA
TGGAGATCACTCTGCTTCCTGTGGCAAGGAATAAAATATGGCCACAACCAGGAAGGGTGG
TGGATGTAGAAAAGACAGCTAACACCCTTTGAGGTGAGCTATAAGGGAGCAGGTAGAGAT
GGGGGTAGGGGTAGGAGGGTCCAGGGTTCTGGGCACAATTGTAGCCTGTACCCTGAAGGA
AGGGAGGGGCTTGTGCTGCTTAAGGTTCTTATAAGGTTGTTCATGGGAGTTGACCCAGCC
TCAGGATTCTGAGAAAGGCCAGCCCTGTTCTTGGCACCAGCATCTCCCAGGAGCCTGAAG
GGTGTGTGCCCAAACAGCCTTACCCTCTGTGGAAATGAGAGCAGAGGTCCTACTGAGCTG
GGGCAGCACTGTCCCTCAGGCCCATTACTGGAACAAAAATAGAGAGGACCTTAAGTCGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1258..1381, 2076..2124, 4354..4452, 4582..4699
1259..1381, 2076..2124, 4354..4452, 4582..4655
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved