Mus_musculus Locus Rpl27a
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl27a
Mus_musculus
Rpl27a
7
SNORA3, SNORA3
1923..2054, 3083..3212
4570
AGGAGTGTAACTCCAGCAGTCAGGAGGTACAAGGCCAGCCTTGGCTTCAGAGTAAGACC
CTGTCTCAAAACAAATACAAGATCTTGAGGAAATGGTGTGGCTAAAGTCAAACTGCCCAG
ATTGTAATGGACTAAACACCGAGCAAGAAGCTAGCAGACAGACAGGATTTGCCCACTCTG
CTTTCTGAGAGTTTTGACTAGAATATTCTTTAGTTTAACGGATCAAGTAAGAAACAATAA
AACAGATTAAGGGGTTAGAATCTTGTGCACAAGTGTACCACTTTTGTTAGCAAGCAGGCT
ACACGCCAGGAACTCATGGATTTAAAAGGAAAACAAGCAAAATTGCCCAGTCCTGAACCC
TTAGAGAATCTGGGCTCTATCGGGAAGAAAAATGTAACTTGGCAATTAGAAGTTACAAGT
GTGATAGTTCGAGTAAACAAGTAACAAAACAGGTCCAAGAAGGTCGACACGGAAAATACT
TGTATGAGGAGCACGCTGGGCTGGGAACCTCGGGTCCAGGGGAGTAAAAGCATACCAGCC
AGAGTCTGGAGAAAATTCAAATGTGATGTTTATACAAAATAGTTACAGAATCTAGATCCC
TGAAGCACAGAAGGCTGTTCAAATTTGGCAGGACATGAAGAGAGGACCAGAGCAAAAGAG
AAGGGCAGTGTCCCTTTAAGGGACGTCAGAGGCCCTGCGGAAGTCTTGCCGATGCTCTGA
GCCACCGCCATTGCTGCCCGGAGACAAAAACCAACCGCACCAGAAAAGAACAGTGCACTC
CGACGATGACCGGCCGCAGCGGCGCTCGACTAGGGAGGAGCTACCGGGGCTTCCGGGGGC
GGGCGCCACCGGTTCACCCCGCCCATCCACACGGAAAGGAAGAGGCGGGCGCCGGGAGCC
GTGACGTCAGGAGCCCTTCCCGAAGCCGGCCTCCTGGCCGGAAATGAAGCATTGGTCCCG
CCCCCGCGCCTGCTACCTCGCGAGACTTCGTGAGCTCCTCCCTTTTCCCTTTCTGCCACC
GCCATGGTAGGTCTTCTCTTGGCCTCCGCTCCATCGCGGAGGGTCGGGGCTCTGCTTCCC
AGCCTTTCAGCTGCTTGCTATGGTCCTAGTGGGTCTCCATGGCTGGGCGTAGCCTGCGGG
GCGGGATGACCCACTCGGGTGTGGGGCGAGGAACGTGGGGCCGCGTGTTCCGACCAGAGC
TGGGATCGCGTGGACGTGCGGGCCCGGGCGGCTGAGCACGCTCTGAGTCCCGGCCTCGGC
TTAGCCGGTGCTCCAGAAGGCAAGTCCTCGTGTGCAGGCCTGATCCGGGCAGGCAGGCAT
TGCTGCCCTCTCCCCGGTCTCCCCATCCTCTAAGCAGGCCTAACCACTTTGCTGTTTTTC
CCACGCAGCCATCCAGACTGAGGAAGACCCGGAAACTCCGGGGCCACGTGAGCCACGGCC
ACGGCCGCATCGGTAAGTGTGCGCCTCCTCGGCGTTTGGCCTTTGGAGTTTTGTTGGAAA
GTAGACATCCGTGGGTGGAAGGAAACACTTGCAGTTCCCCTACTTTATGTTGGTAGCGGG
GTGAGAGTTAAACACATGCCGCTGGGATGTGAAATGCCGTAAATGTTCCTTCTATCCCCG
AGTCTTGATAAATCGGGCTTAGAAACGGATGGTAAACTGAGAGCAGGAATAAGGGCATGT
GAGCAGCTATAAGTCACACAAGTTGCTTTGTGTGCCGACAGGTAAGCACCGCAAGCACCC
AGGCGGCCGCGGGAATGCTGGAGGCATGCACCACCACAGGATCAACTTTGACAAATAGTG
AGTGTTTTGGAAGTGGGGGCTGAAGGGGTGAGTTAGGACGGTGTCTCCCTGGAAACGGGC
TTCTTACCATTTGGTATGGCTAGCTTTAGCAAGTAAACGCTGCACTTGAACTGAGGGGAC
CTGTCCGAGGCTAGAGTCACGCTCAGGTATTGCTTGTTGCCTTAGTGTGCTTAAGTCCTC
GAAGAATAACTGCTGACCTTATTCACTGGCTGTGTGGACTTTCTGGCACAGTCAGTCACC
AGGTTAGTGACATATGTCAAGTTAACCCATTCAAAGTTACGTTGCACCCTATTTAGGGAA
TCCTTTAAGGAGTGGGGGTGCTACTGAGTGACCTGACTTTTAGTTCAAAAATTGTATCTG
GTGCCTGCTGTGTCAATGTTTACAGTAGTGAACACTTACACTCACTAGGAGACAACTACA
AAGATAAGTTTTCTCAGTGAGGCTCTGAAGATGGTTGCCTTCCCTCCCCAGTCACCCAGG
TTACTTTGGGAAAGTTGGTATGCGGCATTACCACTTGAAGAGGAACCAGAGCTTCTGCCC
AACAGTCAACCTGGATAAACTGTGGACATTGGTCAGCGAGCAGACACGGGTCAATGCGGC
AAAAAACAAGACTGGAGTTGCTCCCATCATTGATGTTGTTCGATCAGTGAGTGAACTGAC
TTGCCATTCGTTTTAAAAGATTTTATGTATATGAGAACACTCTTCAGAGAAAAACAACAG
AAAAGGGCATCGGATCCCATTATGTATGGATGGTTGTGAGCTACCATGTGGTTGCTGGGA
ATTGAACACAGGCTCTCTGGAAGTCCAGTCAGTACTTAGAGCTGAGCCATCTCTCCAGCA
GCCTGCCTTGTCACTCTTAATGGGACCTTTAATACACGGTCTTATTTGAAAGCCAAACCT
ATATATACATTTGGCCATTACCTATTAGAAAATTTTAGTAGAATTGTTGCAGGTGATTGA
ATTGGTCACATGCTAATAACTCTTCCTCTGCTTGGTTCCCACTTGTTTCCATTTCTAACA
GGTTTGCTTTTTGAGGTATATAGTTGGTCCAGAATGGTCTTAAGGCACATCCTGGCTTTT
TTTTTTTTTTTTGCAGGTTAAAGTGTTCATTATTTAAGGCCCTATATTGTTAAAAGTACC
CCCATCCCCCCCCCCCCCAAAAAAAAAACCACACCAGCCTAAGTGCAGAGACCCAAACCA
CAGGGAGGCTTTCATGGGCCCATCATTCCTAACCTACTATATTTAGTAGGGTGTAACTGG
TCAGGAGTGGGGGGGGGTGTTTGGCCGAGGCTAGAGTCACATCCTGACATGGTGCTTGTC
CTGGTGTGCTACAGTTCTCGGAGAGAATCGCTGGTCTTGATTCATTGGTAGGGGCCTTCA
GTGTCCCTTCTAGTGCCCAGATCAGAAACATGGCCTATCTGGGCTGGCATATGCTATACT
CTCAACTATGGAGGTGTAGTTGGTGAATCTCTATGATCCCATATTGATCTACATTTGAGT
TAGAGGCCAGGCTTTACATACCTGAAAAGGGGGAATAAGTCAAGTCCTACCTGAATCTTG
GGGTGTTATGTGTCTGATGTATGTTGTGAATCTTTCTATTATAGGGCTACTACAAAGTTC
TGGGCAAGGGAAAGCTCCCTAAGCAACCTGTCATCGTGAAGGCCAAATTCTTCAGCAGAA
GAGCTGAGGAGAAGATTAAGGGTGTTGGAGGTGCCTGTGTTCTGGTGGCTTAAAAGCCAC
ACCGGAGGTTAATTAAATGCTAACATTTTCCATGTGGTCTTTGCATCCTTCCTTGTCTGC
ATGTTGGAAATCTGCCTAACATTCTAGGAAGAGGTGAGGTGTGGGCCCTTGAGAGTCAGT
CTGTGGGAATAAGTGTAGCCCAACTATGCACAGTTGTAAATTCCTACATCCCCGTGTGTA
TTGGTCTTGATATTCAAAGAATTGATGAATGCCATTACTTTCAGTCCAAAGTGAAGAAAC
CTGGTCTCAAAAAATCCCGAGGACCAGAAATGAGATGGGTTTTCCTGAAAATCTAAAGTT
CTTGAAAAACCTTGCCATCCAGATTGCTAGCAACTGCCTAGCTTTGTAAGCTTACTGTGA
TGGACAGGTAGCTCAGGACGACTGGTCACTTAATACTGGACAGATTAGCATGGAAAACTT
AAGGGGAGGAGGAGGTAGTAGGTTCCATCCAGCTTCGCTTTGTTGGTGGCATCTAGGTGT
TGTTCCAAGGGAGCATGCCTACCTGCAACAGGACATCACTGGTTGGGAATACTGTAGAAC
CAGAGCTGTGACCTTTGAACTACTAGAAAGATGAAATTTTATGTAAAGAGTACCTTGGAG
TAAATAAATAAAGCCCAAGATCCTGATTGTCTACATCTTTAAATCTGGAAGTTTTTAGGG
AGTAGGTTGTGTATGCTTAGTACTGACGCTGCTTTAGTAGACAAGTGCGTAGTAAGAGGC
AGTATAAGTTGGGTCACTAAATACGGAAAAATTCATTTTAAGATGTGTTGGGGGACAAAA
GACTTCTGGCTCTAGAGATAATACTGTGTGCTGCCCCTAGTCCAGATGATGTATCTGTTT
ATGGGTGGAGGATGATTGACATGCATGTGGCAGTCGGGACAATTATAGGGTCCGTAACAT
GACAATTGTGTATGTAACCACAGTAATTCTATGTAAAGGTTTAGGCATGTGGCTGCATTG
TTATTTCCTAAAGCATATATTTACAGGTTTTTTTTATAACACTATTATACTAAGATGTAA
GTTATTTTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1388..1451, 1721..1796, 2271..2445, 3404..3570
1023..1025, 1388..1451, 1721..1796, 2271..2445, 3404..3529
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved