Mus_musculus Locus Rps3
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps3
Mus_musculus
Rps3
7
SNORD15, SNORD15
1720..1867, 4945..5089
7748
TAGTTTTTACTTTTGTTCCGTGGGATTAATACAGGGTGAAACAGACTCCCGTGTTTCCA
GTGTGAAGTGAGCCACACACTGCAGTACAAGTTATATCAGCAGGTTCTGCCTCTGGGCAA
TGAACTTTTGCTTGTGTGGACATCAGGGTCTGTGTGAAGGGAAGGTCCTATGGCCTAGAT
TTATACTATTCAACAGTCTGTCCCCGAAGCCCTGGTGCTTTATTATTTTGACAAGCCCCT
GCTGCTGGTATTCCACCCTGCTGCGAGTCAAAAAAGTTCCTGTCTCGGAAAAACAAAACA
AAACAAAACAACCAAAAAATAAAATTTTTTTTTCCCACAGGTTCTAGTGGAGGTGCTCAC
TACCAGAAATCCTACAAATAAGCCCATCTCATGGATCAGGGTTTACCTTTGTAATAATAT
TAAATCTGTGTGCATGTGCGCACGCATGTGTTTTATGCTTGCATATATGTATACGCAGCC
ATGGTTTTCTACTGTCCCACTCACTCTGTAACTTACTGAGCCATCCAGCTGGTCCTCTAA
ATACATTTCAATGAAAGTTTTCATTAGCGTGAACGTGAAGGTGGTAAAATCTGTTAGTGT
GTGCTTATGCCTGTGGTTTGCACCTCTAGTCTGAAGGTTGCTCTTTTCAAATTTTTTATT
TATTTACGTTTTTACTTTTGAGTCAGAAACTCATAAAGGCCAAGCTGGCCTCGAATTCGC
TATGTAGTCAATGATGACCTTAAACTTGTGACCCTCTACTTCGTTAGTGCTGGAACCCCA
AGCTTGCTGAGTACAGAGCACTTTCAGACCGGAACTAGATGTCTACTTCCTGTTCCGCCT
ACATTACAGGTTGCTAGGTTACACCCCCCCTACGCCGTTTTAGACGCAAAACTTCATTTC
CCATGCAAAACTTCATTTCCCATGAACACTTGCAAGGGTCGCCGCGCTGCGCGGCGTCAT
TGCTCCCGCCCTATATACCTACTTCCGCCCGCGAGCCACTTCCTTTCCTTTCAGCGGCGC
GCGGCTGCAAGATGGCGGTGCAGATTTCCAAGAAGAGGAAGGTAAGCGTCTGGGCCCGGT
TCGGGAGTCCGCCGCGGGTTCTACAAGTGCCAGGGAGGCCTGTGGCTCCGTGATCAGTCC
TGTGGAGCGTCTGGGGCCGCCTGCCGTCTCTTCGAGCCTCGGATGGCCGTAGATTGTGTA
TTGGGCCGGAGCCGGGCGAGTGCTGTGTGCCTGGGCAAGGGAGGGACAAACTCCTCGAGT
TCTGGACCGACTCGAACACCGGGCGCCTCCAGTTCCGGACTAGACACCTTTGAGCGTTTC
TTGGTCTCCATAATAGTAATCCTGTGGCACAGTTAGAGGGCGTGTGCCATCAGATCTAGT
CCAGTTTCTTTAGTAAGTGAAGTTTAGCAGTCCCTTCTCTTAGTCGCGTGATCCTGCAAG
TGGCCATAGTTGAAAGCCTACTTACTGACTGCTGCCGTGTTCACTCGGGACCCGGAGCTG
CAGCGTCCCTGTGGTTATCATTTCATGGGGGAAAAGTGTGCAGGTTGCCAGGTTTAGAAA
TAGATGGTCTGTCGTTTGTGCTTATGCACACAGATGATAAACCTGTTTTGAGTCAGGATT
CCTCTCCTATCCGAGGTACAACTTACAGTCCCAGCTGTACATGTGCTACTTGGAGACAGA
TTTTTCTTTGTCTCTTGGGTGTAGATTATGCCGTAGAGCCCTTCGATGAAGAGGTGATGA
CGAGTCTGAGTAGGAAGTGTTGTCTTTGTCCAAGATGCCTCACTATGCTGCGTTCTGTGG
CACAGCTGAAAGCACTGTGGTCAAAAGAAACTTCCTAAAGATGACCAAGAGGCATTTGTC
TGAGAAGGGTTGCTGCTTTTCTGTAGGGCCATTGGGCTTGCTCTGACTAACCCTGTCTTC
ACCTCAGAGGTAACTTGTTTCCTTTGGTTCAGTTTGTAGCTGATGGCATCTTCAAAGCTG
AGCTGAATGAATTTCTCACTCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAAGTCC
GAGTTACACCAACCAGGACAGAAATCATTATTTTAGCCACCAGGTAGAAATACCATTGAT
TGTCACCTGTAAATACTGTGTGTACTGAGATGCTGTGTAAACTTGGGCCAACCAAGCAGT
AAATCTGGCCTCAGTGGGTGTAACTGCTTTGTTAGAACTGCATTTGGGAAGAACTTACCT
TCCATTTAACGTGTGTGCTGGCGTTGTGGTGGGCGGCAGGTGGGATCTTGAGTAAATGGT
TGCGCTTCCCCTCTACAGGACACAGAATGTTCTTGGGGAGAAGGGTCGTCGGATCAGAGA
GTTGACCGCAGTTGTCCAGAAGCGCTTTGGCTTCCCTGAAGGCAGCGTAGAGGTGAGTTC
CTCTGCTTTATCTCCCGGGGGTTTTAGACTGAGTTGGGATGTGGCTTCTGCTATAGAATT
GTACTTCTGAAAACCTGACATGGCCAGTGACAGTCACAGGTACTTGATGCTCTGCCAAAA
TTTCCTTAAAAGCAGAGCGATTGCCATGCATGGCGGGGGCCCATATTCTTGTCCTGGCAC
GCAGAAGGCAGGATGACGGCGGGGCAGAGCTAGTCAGGGCTGCTGTAGTGAGACCCTGTC
TTAAACCACAAACAGTATGATATTCTGGTGGTCGAATGTAGAAATAATGCATGGGTGACT
GGCTATCCTTAGTGTGGTTGTGAGGAACCAGAGTAGAAGGGCGATTCAGCCTTCATCGCT
GCCTTGTGTGGGTAGTCGTGGTACTTGAGTATCTAAGGGATATTACAATGGCTTAATTGA
AGATGGGTGAGTGACAGGAATGTACTTTGCTTTCTTTAAAGCTTTATGCAGAGAAAGTGG
CCACAAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTACGCTACAAACTCCTTGGAG
GGCTTGCGGTTCGAAGGTGAGTGTCCTGAGACTTGATGGTCATGCCCTCCTGTGGATTAG
TGTGTGCTAGCATTTTTGTTAGCAAATAACTTGATTGACAGAATCATCTAGTCTCTGGTG
GTGTAGCCCATCCCCCCACTGAACCTAGTTAGGCTAACTAGGCTAGTAGTAGGCTGGTGG
ATGAAGGACCTATTGTTGGTGACACATGCCTGTATGCCAGCACTGGGAGGACCAGCCTGG
GCTGTGGGATGAGCCCCGAAAAAATGGTCAGTGCTCTGACGAGGGAATGCTGTGGGTATG
TTGAGAATGAAACGAGTAGATAGAATCATAACAGGGAGGGGCATCCGCTTTGTGAGGTTT
AGCAAGGACCCTTGATAGGTGAGCAGGAAAGCATCCTGCCTGTTACTGTACCTGGGAGGA
GTATCTGGTTGGGAGTTGTAGCTTTGGCAGTGCAGGTTTCAAAACAAGCTAGAAGTCATG
CAGCTCTACTAACTAATGCATTCACTGTGTGGATATAGAGATAGCAGTTCTAAAGGGAAA
GACATTTACACTAGCAATTGGCCAGGGTTCATAATGCCTACCCCCCAATCTTCGCACTGG
AGGTAGAAAATCAGCAATGCAAAGCTCCAAAGCCAGCCTTAGCCTCAAAACAGAGGCTAG
TCTCAGGGGAGGCCCTCTCAAAAACCCAACGTTTCCTGTAAATTTTATGGCACTGAGAAG
TGATGTAACGATCAGGTAAGGGGCCTGACATTGTTTCAGGAGTTGTACAACCTTGCCTTT
GTTATAAGGATTAGATGTTGAGAAGGCCAATTTGGTTCTTTGTTGAGAGTCAGGGTCTCA
CTGTATAGCCTAGCTGACCTCCAAGTCAGGTTGCTTGCTGAAATTAAGGTGTGTGCCACT
ACACCTGGCTTTAACCGGATTTTGTTTCTCTGTGACCTTAGGCCAGGCTGGCCTCGAACT
CAGATCCTCCTTCCTCTGCCTCCCTAGTGCTGGGATTAAAGGTGTGGGCCACCACTCCTA
GCTTTCTAGTGTTGTATAGGCAAAAGGGTTTTTTGGTGCTATTAATGCTTAGGTTTCCTG
GTGGGGTGGATTCTGGAGGTGGAGGGGCCTCCCATGGCCTGCACTTACGAGAGTTTTGTG
TACTTCTCAAAAAATGCATATTCCTGCCAGGTGTGGCTTGTGGTATTGCACACCTTTAAT
CCATAGCTCTCAAGACAGTGTGGTGGATCTTCTGCAACCTTGTCCTGACAGCAAAGGTCC
TTGGCCACCAGACAAAGTTGAGCCTGACAGCCTGGGTTTGGTGTCTAAAGGAAGGAAACT
GACTCTAGTTGTCTCCTGGCCTCCATGCAGTCACGTCATGTGCATGCTGCATGGTAATAG
TTTAACTAGTAAGAGATGTAAAAACATGCCTCTCTTTGAGTTTGGCCAGCCCAGATAACT
GGCTTAGAGAAGGACCTGGGCATGGGGGTATAAAATTTTCTAGAGGTGATTCTAGTATGC
AGGCCAAGGCTGGAAAGCATTTGGTCAGTGAATGGCTGTTCTGGTATAACTGGTTGTTTC
TTCTGTCTACCATTGGAGAGTTGTTAATGTGAAAACCAAATAGGCAGGTTGTGTCTTTGG
TAATACCAGATGAATCTTGTCTTCCAAAGGGCCTGCTATGGTGTGCTTCGGTTCATTATG
GAGAGTGGGGCCAAGGGCTGCGAGGTTGTGGTGTCTGGGAAGCTCCGAGGACAGAGGGCC
AAGTCCATGAAGTTTGTGGATGGTCTGATGATTCACAGTGGAGACCCTGTTAACTACTAT
GTCGACACAGCTGTGCGCCATGTGCTCCTCAGACAGGGTAAGTAGCTGAGTCCCTTTAAG
AACTGGGTAGCTAGGAATGCCTAGGGCAGAGAGTGGCATTTCTATAGACTTATGTTCAGG
AGGAGTTGTGGATTCACTTCAGGGGCTGGGAAAAGTAGCATTGTTGAAATGGTCATATCA
GTTGTTAGACATAGCCTTCTGTGCCCTTCAGTGATGACACGATGACGAGTCAGAATGGCC
ACGTCTTGCTCTTGGTCCCTGTCAGTGCCATGTTCTGTGGTGCTGTACATGGTTCCCTTG
GCAAAAGTGTCCTGCGCACTGATTGATTTAGAGGCATTTGTCTGAGAAGGGAACAGCGCT
CAGTGCTTTTGGATAGATGCTTTCCCCGACATCCTCTGTGGTGGAGAAATGCCAGCTCAC
TCCTAACCCTGGCGTCTTCTAGGTGTGCTGGGCATCAAAGTGAAGATCATGCTGCCCTGG
GACCCAAGTGGTAAGATTGGTCCCAAGAAGCCTCTGCCTGATCATGTGAGCATCGTGGAA
CCTAAAGATGAAATCCTGCCCACGACCCCCATCTCCGAACAGAAGGGTGGGAAGCCAGAG
CCACCAGCCATGCCCCAGCCAGTGCCTACAGCATAACAGGTATGTCTGCAGTGACCTTCC
CAGGTCAAACTGCTTTTACTGGTCTTTCCTCTGATGTTTCAGTTTGTGAATAGGGTTATT
TTAGCTTAATGTGGGAGAATACAAGTTGGGATGTGGTGTCCGATTGACAAGTCGGTCAGT
GGGTGAATACCCACTTAGTTCGATGTCTTTGCTCAAGAGTTTCCAGCTCCTCTTGTGGGC
ATTGGTGAAGGTAGTATCAAGCCTTTGTACTGGGTTGTATTAAGGCAGGCTGAGTGGGAG
TGGAGTAAATGAAGGCACGCAGGTGCATTTCTCTTACCATTGTTATTTTATTTGGTTTCA
GGGTCTTGGCAGCTGCATCTGGAGGCATTTAATAAAATAAAGACATTTAATAAAATCTTG
AACAAAGACAAGGCCTGACTGGATTGTGTCCAGTATTCAACTGAGTTATGTTGTCTATGG
AGCCATGCTTATTCTGTTGGTTTAAGCTGGAGGGCATGAGCAGAGCTGACCAGAGAAGTC
ATGAAGTTGGTGACCCTGTGTTGAACAATTGAGGGTTAGAAGAGCAGTTTGGTTTTGGTG
CTCTTGATGGAACCCAGGTGCTTGGACATAGTAAGCACACATAAGACAGAGTAAGACTGC
TGTGTCTCTGGCCTGGAGTAGTCTTTCTTGCTTTTTTTTTTTTTTTTTTTTTTCTCTAGA
ATGAAAGCAGATGGCCCAGCGAGTTAGGTGCTTCCTATGAAAGCATGTGTGCTGGTTTGT
CATGCACACAGCCCTGCAGGAGAGAGTATGGCAACACAGCCGCTCAGCATCCCAAGATAA
AAAGGGAGTTTCTACTGCCATTTTGAGCTTGGGAGTTTGAAATGTAAAGCCTGTCCATAT
GTTTTAAGGATCCATGTATTTCTGTTTTGTTTGTTTTTCAAAACAGGGTTTCTCTGTAGC
CCTGGCTGTCCTGGAACCCACTCTGTATGTAGACCAGGCTGGCCTTGAACTCAGAAATCC
ACCTGCCTCTGGCGATCCATATATTTCTAAGTCCTGTACTTAGACGCTGTTTTGGAAAAT
TCATTTTGGAAGCATTTACTGTTGGTGTGTTTTGTGGGGAATGAATGATAGCTTGGGAAT
TCTTTTCTGTTTGGTGAGAGTGAAGCTGTCAGCCCGGTTGTAGCCTGGCTGGTGCTCAAA
GGCTTTCTCTCATTGTCTTCACCTACGTAGCTTTACGTGGGGTAAGGACTTAAGTTACTT
AAGTTGGGTGCACACTGACCATGTCCACAACCTGTTAACCAACTCTACATGATGAGTACA
GATGTACCTTTTTAGAAAGTGTTAATGTGTAGCCCTGGCTGGCCTCTGCCTCAGGGTATT
ATGAATAAAGTGTGCAACCTTCATCTGGTTGATTAAACTCATGAGTATGCAATTATTTGA
CATCTGAGGTTTCTAGACACTGGCACAGCTAATTATTTACTGGACTCTGGTAGAGTGTGC
TTTATGAGACCTCATGAAAAAAAATTGGTTCCTCTTCCAGAGAACCCAAAGTTAGATCCC
TAGCACCTGTCTAATTGATGTTCACACACAACTGAAACCCTACCTTTTTGGGGCCACAAA
AGCAAGGCCTTTGAGCATGCTTAGTTAAGTCTGGTCTGGCACATCAGTTGTATATATTCT
ATTAGATATTTAAAAGTTCAGCCTGGCAGGGCGGTGGTGGCACACACCTTTAATCCCAGC
ACTTGGGAGGCAGAGGTAGGCGGATTTCTGAGTTTGAGGCTAGCCTGGTCTACACACAAA
TCCTGTATGAAAACCAAAAAAAAAGTCAGCCTGTGAGATGGTGTTTGCTTCTTTCCCAGG
AGGTGTCACTGTATCACAGCATTGCTATAGAGGACCAAGTAGGGAATCTTACCCCTCTAA
GCCAGCAGGAATCTCAGGGCTGGGAAGGGAAAACCAAAATACAGGACTTGAACTTGGAAC
ATGTTGGCAGCGTGAGATCAGTACTGAAGTGTTGTAGGTACTTTGGGGCGGTGGGGTGGG
GGTGCGTGACTGGCCAGCAACTCAGGTCCACCTACCTGTGATCATTTTTTTTTCAATACA
TTTTTTTCTTCCTTGGGGCTATTACCTTTTGATGCTAAAATCATCTTTGTTTTGAGGTGA
CTTTAACCCCCTAGGCCACTAGTAACATTGAGCATCTTCACTGTCTAAGGGAGCTTGTCT
ATTTCTCTGAGGGTTTACCTTAACATCAGACCCAAAGCTGGGAATGTCAACTGTTCTCAA
GCCCTCTAATTACAAATAAAACTGCAGTCCTGGGGATCTATGATAGACTCAGGCTGGGCA
GTTGTCCACGGAGGGTGTCACTGCTATGTTAGATGATACATCCTGGTGGCTGATAAGCTA
CCCATGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 1952..2082, 2298..2391, 2861..2955, 4589..4748, 6337..6748
1031..1060, 1952..2082, 2298..2391, 2861..2955, 4589..4748, 6337..6399
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved