Mus_musculus Locus Rpl13a
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl13a
Mus_musculus
Rpl13a
7
SNORD32, snoZ195, SNORD34, SNORD35
2275..2355, 2791..2874, 3068..3137, 3303..3392
4815
TTTCAAAATCTTGGTTTGTTGGCTTTCCAGAAGCTGAGGCAGGATCTTAAATTTAAGGT
CAGCCAGGATTGCAGAAATCTTACGTCAGAAACCCAAACCAACGACAAAAGATTCTATTT
GTTTTCCGAGGCCTCCAGTAGCCCAGGGTCAGCACAGGGCACGCCCCATGGGAATTTGAT
GTGCAGACGCAACTCAATTCCCCAAAACCATAGCCCCAAAGTGTAACAAGCAAGCAAACG
GTGCTGGCACCTACAGGAGGACTCGACTCAGGCTCGGCTGGTTAGGGAGGTTTTCAGGAC
AAAACGAGTCTTTGATAGCCAACAGTCTTTTGGTTAGTTATTTCCCTTCGGAGGCGGGCG
GTTAGAGGCGCACAGACGGGAGGGCAGCGCGGACAACAGTCACGGAAACAAAGGCCTTTG
GGGATAGAAGCGAGTGAGGGCGTCTGCGTCTCGGGACCCTCAAAGCCCCTCATTCACCCC
ATCCTCCTCCATCCAGGAAGGCTTCCTCCACCCGTTGGAAGGCTTCCTCCACCCGAGACT
CCCAGGTTCAGGACAGCCAGCGATGGTCAGCCCACTGTGGGGTTGAGGGGAGGGACCGCT
GCACGAGCAGCTCTGAAGGGCCGACAGGGACTATGCTCGCCCCCTCATGGACACCACATG
TTCTGCAGCCGCCATCACTTGATGGGAGTAATGGCGCTGCACATGGCAGACACCGGAACG
GAGAAGAGCGATCCCTTCAAATATGGCGGCTGCGGCTTGGCCGGCATTGTACGGCTGAAG
CCGCTCCGAAACCCACGTGACATCCCGCCCCGCACAGTCATGGCCGCCAAGAGCCAACTC
AGGCGACATTCTGATTGGACAAAATAAAAATGGCCCGCCTCGATAGACGCGCACTCACCG
CTTCGACCAATTAGAAGACGGAAACTCTTCGGTTCGAGCCGTCTGCGTCACTTCCTCCGC
CCCTGCAGCAAGGGATAAGAAACCCTGCGACAAGACCTCCTCCTTTCCCAGGCGGCTGCC
GAAGATGGCGGAGGGGCAGGTTCGGACTCTGCGCGCGCCGGGCGGTGTGGGGTCGGGTGG
GTGCCAGGCGGGAGCGCAGTGAGGGGCCACTGCTCCCCGCCGCTTGTGCGATGGGACTTA
GCAAACGTCTCACGCGAGGGGACTGTGTAACGGGCGTAACAAGCCGCGGCTGCCTAGGTA
TGGGGCGATGGAAATGCAGCGGGTTTTCTGGGGAAGACGGGAGTGGGGCTGGGGTTCCAA
CACCAGAAACAACTTTTACAGGTTGTAATCTCAGGCGTTGGGGTGCGGGGAGCTTGCAAT
CTCTCATGCCTGGTGTATGTATGTAAGATAAGGAGAAACTGTCGCAGGCTCCTGCTTTGC
ATGACTTTAGGGCACCGGATTCCTGTAACATCTGATCTGAAGGCTTGTAGGCCTTTTGAG
GGTGTTTTCGGTGTTCTTCAGAATTGGGGAGATTGATAAGACAGACTTTAAATATTACTT
ATTCACCCGACTGAAGCAGGAACCTCTTCATTTTGAGGCTGGTCAGGAATTGCCTGTACC
TTCCTCCTGACTTTAGATTCCTTGACAGGTTGCTGCTCAGGAAGTAAATGGTGCTGTTTG
GGACAGTTTTGCCCTTTAAAAAGAACTTGGGAAGTTCCGGAGACCCTCCAGTAACAGCAA
TAAACAGGGTGGCTGTGGAATGGGCTTCTTCTGTAGTTTGGGTTGGGATGCAGACATGTG
CCTCCATGCCTGAGACGGGATTTAGCTTTGTAATCCAGTCTGCACTGCTCAGAATCACAG
GACGATGTGTGCTTAGCTAAATCGGGTTCTTTTGAGTGCATATAAGAAAGGTTCTGCTTG
AGCATCTGAGGATCCGATGAAAAGTTACAACAGGCTAAAGTCTGAAAGCAGGTCTGGTCA
ATTTTGGAGTGAACGGTGTGCCACTGGATCCCAGCTATCCTGGGATTTGAGGCCTGGAAG
GGTTAAATGAAGTTCCATTTTAAAAAATCAACTTATATACACAATAGGAATCCTATGCCT
GCTGAGGCTTTGTTAGTACTATAGTGGCCCTTTGGGACACTTGCTTCATCTGGGTAGTAG
GCATCCTGACGGGTTGCTAACCTGGAATAGGGGAAGCCAAACTGTTTCCTAAGCATTCTT
GTTTCCACAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCAT
TGTGGCCAAGCAGGTACTTCTGGGTAAGTTTCATTCACCATTTACCTTTGCCTGGGAGTC
CATGATGAGCAACACTCACCATCTTTCGTTTGAGTCTCACGACTGTGAGATCAACCCATG
CACCGCTCTGAGACTCGCCAGCCCCTGCTTTCTTGGGACCCCTGGCCTAAAAATACTTTT
GGAGCAAGAGATCTGCCTTCCAAGAGGCTTTGCTGACTAATCTCCAACTCCCTGTTAACT
CTAGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAACTTCTAC
AGAAACAAGTGTGAGTTAGGGCTGGGGCAGTGGTCTTCAGGCGGGCTGTTGCCTTGCTCC
TGGACAAGCAGGCTATCTGCTCTGCTCTTGGGTCCAAGGGTGCCTCACATACTTTTGTCC
TGACAGTAAAGTATCTGGCCTTTCTCCGGAAGCGGATGAATACCAACCCCTCCCGAGGCC
CCTACCACTTCCGAGCCCCCAGCCGCATTTTCTGGCGCACTGTGCGAGGTGAGTTGGTGA
TGTGGTGACATGTAGGACAGGGTAGGCTCTGGCAGCTTGTGATGAGACATCTCCCACTCA
TGTTCGAGTTGCTCGACTATGAGATGACTCTACATGCACTACCATCTGAGGCTGTTCTAG
CCCTTGCCCTGGGGTCAGACGGGGTTCTCAGCACCTCTGATGAGGCCCGCTGTTACCCCC
ACAGGCATGCTGCCCCACAAGACCAAGAGAGGCCAGGCTGCCCTGGAGCGCCTCAAGGTG
TTGGATGGGATCCCTCCACCCTATGACAAGGTGAGCCTTGCAAGCCTAGCCTTACAGCCT
CTGCGTCCAGCGTCTGTGATGTTCTGCTATTACCTACATTGTTTGAGCCTCATGAAAACC
CCACTGGCTGAGACGCCTACCCTGCTGGCCTTCTTGCTAGGTGTTCCCAACAGGTCTCTG
AGCATCTCTTTCTCTCAACAGAAAAAGCGGATGGTGGTCCCTGCTGCTCTCAAGGTTGTT
CGGCTGAAGCCTACCAGAAAGGTAAGCTCTAGGTTACAGGTTAGGCTTGTGAGCCTCAAG
ACTGGCACATGATGTTCTTATTCTCACGATGGTCTTCGGATGCCACAGTTAGGGCAGTGC
CGATAATGCCAAAGGCTAAGCTGATGCCAGGAGGGCTCCCGTGCTGGGGATGAGTCCTTG
AAATAGGGTCCCTAGGCCCTCCGGCTCACCCTTGTGCTGCTGGGGCACATTCCATGTCCT
TACAGCCTTGTGCCTCTGCAGTTTGCTTACCTGGGGCGTCTGGCGCATGAGGTCGGGTGG
AAGTACCAGGCAGTGACAGCCACTCTGGAGGAGAAACGGAAGGAAAAGGCCAAGATGCAC
TATCGGAAGAAGAAGCAGATCTTGGTGAGGACGGACACTGAGATCCAGGATTAGGGGGGC
GCAGGTGAGAAGCAACCGCTCTGACATGTGTCTTTTCACACCACAGAGGTTACGGAAACA
GGCAGAAAAGAATGTGGAGAAGAAAATCTGCAAGTTCACAGAGGTCCTCAAGACCAACGG
ACTCCTGGTGTGAACCCAATAAAGACTGTTTGCCTCATGCCTGCCTGGCCTGCCCTTCCT
CCGCCGCCAACTAGGGAAGTGGGGACCAAAGGTTCCTTAGGCACTGCTCCTGTGGGTAGA
GGGGACATTAGAGAGCTGACAGCGCACCACCTGCATGAGTTTTTATTAAAGTGCAAACCA
TGGGATGAATCAGTTGAGCTTCAGTGTTGAAAATGAGTAGCAGGGCTGCCCCACCCACCT
GACCAAGTACCCTATTCTGCAGCTATGAAAATGAGATCTGCACATGAGCTGGGGTTCACA
AGTGCACACTTGGAGCACTGCCTTGCTCCTTCCCAGCAGACCACAAAGCAGTATTTTTCT
GGAGGATTTTATGTGCTAATAAATTATTTGACTTAAGTGTGTACGATGTGTGCTGTGCAG
AGAGGGGCAGAGGGCACCAGCAGGTCATCTGCATGGGGGGCCCCTTTGGGTGAATCCTTG
CTCACGGGATAGGCTTTGTTGCTCAAAAGTTGCAGATATACATCTTGGGTCCTGTCCTAG
ATGGTGTTACTGTAAGTCAGCACCAAGATACAAGAGCTGGTACCTGGACTGTAGGAGGTC
AGGCCATGACACAAAGGCTGGGACTAAAGGCATTTACCACGCCTGAGTCTTCTGGTTCTT
TAAACATCAAATCCTTCCGGGGGCTGGCGAGATGGCTCAGTGGTTAAGAGCACAGACTGC
TCTTACGAAGGATCCGAGTTCAAATCCCAGCAACCAAATGGTGCCTAACAACTATCCATA
ATGAAATCTGATGCCCTCTTCTGGAGTATCTGAGAACAGCTACAGTGTACTTACATATAA
TCTTAAAAATGCTTCCCATGTTAACCACCACTAGAGTTTTTATTACAGCTAGCTGACCTG
GAAGCCAAGTCCTTATGCCTCCGTGAGTGCTGGGGTTAAAAAGATCCAGCACCACTCAAA
ATGTCAATCTATTTTGAAAATATGCTTTATACTGTTCTAGCCCATCTGTGCAGGGCTAGA
ACGGTGAATACGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 2170..2242, 2464..2529, 2646..2747, 2944..3029, 3201..3260, 3501..3623, 3706..3815
1024..1038, 2170..2242, 2464..2529, 2646..2747, 2944..3029, 3201..3260, 3501..3623, 3706..3789
NM_009438.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved