Mus_musculus Locus Rps11
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps11
Mus_musculus
Rps11
7
SNORD35
2279..2365
4002
acaagagctggtacctggactgtaggaggtcaggccatgacacaaaggctgggactaaa
ggcatttaccacgcctgagtcttctggttctttaaacatcaaatccttccgggggctggc
gagatggctcagtggttaagagcacagactgctcttacgaaggatccgagttcaaatccc
agcaaccaaatggtgcctaacaactatccataatgaaatctgatgccctcttctggagta
tctgagaacagctacagtgtacttacatataatcttaaaaatgcttcccatgttaaccac
cactagagtttttattacagctagctgacctggaagccaagtccttatgcctccgtgagt
gctggggttaaaaagatccagcaccactcaaaatgtcaatctattttgaaaatatgcttt
atactgttctagcccatctgtgcagggctagaacggtgaatacgagaaactgacacaagc
ttttgccacctggctaaatggttcctctattacctggggtggtcacctaaggttagacac
tcatccacgagtagtcaggacataaacccatcaaagtgtgggtagacgcgcagcctgaga
tactgtcaacaaaggacatgcgaccttggtgacgtcggcctttaataaaaggaagaaagg
ttgactattcggtcgacgctggctgctcctgacatcgtatggcagatactctgctgtaaa
gcggttcacccctttcttgagacccgctctgcacggccgcttctctctggaaactgaatc
ccagcacgtgtttcccaacccgtacggcacgccttctccgccctaagcctcgccgtacca
catgatgcacgtttcctccacatcgtgctcctgaaatctcgcgagatgataggatcttcc
cgccccttagtcctcccccgtcatggcggcgtacggacagtcccaggaacgcgggctctc
gccggaagtacctcccacctccgtgaggataaccccgcgtcACTTCCGCCCCGACCTCGC
GTGGTGAATAAGGAAGCCGGGAGCGGCCCTGCCTCTCCCTTTCTCCGGCGGCCGGGAAGA
TGGCGGACATTCAGgttcgagcgtttagttgctttcccccgacgcttcggtgtggagcgt
atcccttggcgtcctcgttgtcttacgcattagctgaagcgaggatgcctgcgaatgcct
tcgtctcaggcggctcggaaatccgggctctacgcagtaatggggtccctggcgcttcgg
gagttggttcttaaagctcagagcttaacgggtgagggattgtggcgggaggagggcatc
ctgcggcgcgggagtcctgcggcggcagagccggggacactgggtaaagcaggttttttc
cccttgatggagactgaggcccggacctcgtgcgctctacggcagggctgcggtcccgac
ctcgctgtagttttcagtgtgagcgcagctctggcctcgatgagcttaggcttgtcttaa
acttgccatcctgcctcaacctcaaccgggatgacagatccggcccaccaggctcggcta
cgtggacataagcttgaatcccgaatgagtggatttgtatgttttggaggtccagtctgg
ctgaaaagctctttttgatctcagccgtgagttctgcaggctgtggaggtgttagatggg
acgcagtgtgtgagctaaactagacttggggtggttggagagccctgaccagccggtttt
ggcgattggggcaaataaggttgaaggtaggaaggaagaaatattgtctctgatttcctt
gaactttacctgcaacctcaccaaattctcatccctacagACGGAGCGTGCTTACCAAAA
GCAGCCTACGATCTTTCAAAACAAGAAGCGGGTTCTGCTGGGAGAAACCGGCAAGGAAAA
ACTCCCTCGGTACTACAAGAATATCGGTCTAGGCTTCAAGACGCCTAAAGAGgtacagga
ccctccagcagatgagatccctgctgccctgcacgtgtgggagcacagccaccccgcccc
cttcacagtggcttcccatgggcccctgggaattgtagtatgggccctgaggcgtcatcc
ttggttctgtttaggaagtggtaatctaaaccccactttcttaactttgcagGCTATTGA
GGGTACCTACATAGACAAGAAATGCCCCTTCACTGGTAACGTCTCCATCCGAGGTCGGAT
CCTGTCTGgtgagtgggatgttggaagggtggttctaggttcctgcgtccaggggcgctg
gcaagtgatgtctgttctcacgatggtcttcagatgtcctctagggcactgctgagacag
ccagttgacaaagctgatgccataaatggagcttcttgggagccccgttcaactgactcc
tacctgctaacacctttctgttactctcccagGTGTCGTGACGAAGATGAAGATGCAGAG
GACCATTGTCATCCGCCGGGACTATCTCCATTACATCCGAAAGTACAATCGCTTTGAGAA
GCGTCACAAGAACATGTCTGTGCACCTGTCCCCCTGTTTCAGgtgactctggtagcttgg
gataatgactctagacaagacagtcactggctaggctggaggtgtcccatgggcagagca
gtgtggggtccaggagtgtgtagactgctgtgtgaacgtctgggaactagaagttgtagt
ttgttagtcttagcaactgcgtagatggtgactggttgggtggagcaagggtggccccca
cccctttggcctgtctggatgaaggaattgctggggaggcccctcctgaagactccttgt
ctgaccccacagGGATGTACAGATCGGAGACATTGTCACAGTTGGAGAGTGCAGGCCCCT
GAGCAAGACTGTGCGATTCAATGTGCTCAAGGTCACCAAGGCTGCTGGCACCAAGAAGCA
GTTTCAGAAGTTCTAAGGGGACTCTGGCCAATGCCCTAGAACAAATAAAGTTATTTTCCA
ACGtacagaacaggcttggagtctcatgtgtcctgggacagagcaaagattgccagggct
ttcctgagctggaggtatctgctgcatttatgagcctctaaatcttggtaaccaagtaga
acacccagggtcagctacctggtgcaggcagcccctgctctgcctgcctctcaggaggaa
gtaagggtggagcctctgaccttagtttaggtctgagctcttcagtgtccctgggaacca
cctgggtctctggtcttcccatactcaccttgcaggtgaagacacctaggaaggggcaag
ttctccaacttgagtatcatgatctgcttgaacccctgtagccactgcctcccctctggc
ttatgtccagggacagggccaacaaggacaggaacccttcagcagtgagatgagaagaag
gccccaggttgtccaggatggatgttggagtgatgggaacacccacttaggaagggaccc
aaggcatcccctgtatgtaggccaaacctggggaaaagtcccttggctggagggagaagc
tggagttgttgctgctggggttcccaagtccctatcccccaggcctgtaccagggtctga
ggcacagcactggtacaagggttgggagacagggcattgagaagagtcctctgcctgcaa
gagatgctgcggaaagcactgcttcaccacggccttctgcatttaaccaggctgctgagg
gagggggttcctgtcaaaggaagtgggcctgcatcaaagcgagcaggaaggggcagggac
aggtcaggaggggcaccgcccaagctgggtgcctgccagccacccaggagtagagccact
aagcagaggaggggcgagccccagagctacaggggacagggaccctgaggaatctaaagc
caattgttgagaggtgtggccccctccagccgcaggtgcttccgttccgggtggggctgt
gtttacaacagcccagctcccctgtttcctctcaggggtgctt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1840..1971, 2152..2227, 2432..2561, 2832..3002
1079..1093, 1840..1971, 2152..2227, 2432..2561, 2832..2955
NM_013725.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved