Mus_musculus Locus 2410002F23Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus 2410002F23Rik
Mus_musculus
2410002F23Rik
7
SNORD88, SNORD88, SNORD88, SNORD88
2369..2459, 4131..4220, 4414..4503, 4729..4821
7598
CTCGTTTACCTAAGAGAAGAATCTTTCCCTTTACTTCAGACCACTAGGTTCCCAGGCCA
GTCTCCCCAGCGGAATGAGAAAGAGCCCTAATGAGCAGAGGGCCAGCTAAACAAAGAATA
CTCAGGTCACATTAAGGAATCTAGAGCTTGAAGAGTGTAACATAGACTATTTGGAGGGCA
AAATGAAGAAAGAGAGAACTGGTATGAGGTGCAGACTTTTAAAAAAAAAATGTTCTATGA
CTTCTGTGGTTGAGGACCCACTTCGAGCTCATCCAAGTATTCAGAACCCTGACCCTTATC
CCCCAAGACCTAGGGGTTCCAGCCCTCCGCCTCCTTCCTCAGACCCAGCAGTCCTTATCT
CAGCCTCCAGATTCAAACCCAGTAGTGCAGCCCTCCAGCCTCACGCCCTCATACACAAGG
GTCCAGACACCACCCACCCTCCCTCACACCCAGGGGTCCAGACCCCAACCTGCCCTCTTT
CTGGCACAGGGAATTCCCCTCCTTTCCGCCCTAGCGTCCCCGCTCCGGGCCCGCACATCA
CAGAACCCAGCCCTCTAACTACACCACACCCATGGTTCCCTAAAAGTCTGCCAGTGTGTG
CTGGTCCTGCCTCCCGCGCCGCAGCTGCGACTACTGCCGGGTGGGCCCTTTTAGCGGACC
CCAGCTTCTGCAGCAAAAACGAGCTAGCCTGCCGCGCTGGCAAGTCGGGGGATTTCCGGT
TCTGGCCAAACCCCCACCCCATGGGGGGCTTTCTCGTCCCGCCCTCTCCTTGGGAGCTGT
CTAAGAGCTGCCTGACGGAAGTAACGGAAGAACCTTTCAGATATGTTCTTCATTCTCTTC
ATCCTCTTTGGGAACAACGTACCTTATCACCTGATCAGGAATGTCCTAAGGGCAACAGAC
GTTTATTCTTTCTGCCACCGTGAAAGCAGGATCCCCGGCTCAGGCGTAAGTGTGGGCTAC
CTCAGGGCGGGGCCCAAGAGCCGCTGGAGGCGGGGCCTTGCGAGCGCGATGGGTGGGGCT
GACGGGCAGCGCGCGCTATAAATGGGGACACGCGGCGGTGGCGCGCGCCTGTGGCGATCG
CGTGTGAGGTGAGGTCTGTCCCGGTGAGTTTTTCCACGGTGTTGGCCTCGGTACCTTCCA
GTCGGTGGTGCTGCTTTGCACCCTGGGAAGCACGTGTCCCGAGGTGTCCGTGGCCTGGTC
ACGGGTGTACCTGTCGCGCGGACGGGCTCAAGGGCGCTGCTTGGGGCCGCGGGCGTGCTC
GGGCTGGAACCAGGGTTTCTCTCGAAGGGGCGGATGCGGGTACTTTCGGGACAATGCCTT
TCGCCAGGTTTGTGGAGCTTGGGATGCCGGGCCAGGCCTTCCTTTGTCTTGCCTTAGCCG
GGCTACGCCATTTCTGCTGCTCACGTCGCGGGTCTTGTCCGCCATCTTCCCGGTTTTTTT
TTTTTTTTTAGGCGACAGGGAGGGGGGTGTGTGACATAGAATCTTTCCTCCCAGTGACAG
CCCCGTGCTACCTGCAGGTTCTCTCCGTAGGAAATCTCTACCACTGCCCCTCCCCCGTGT
GGGATTTTGGCAATTTTGTGCAACCTAGAACACATGAGGGCTGGAGGAGGATGGGGTGTA
GGGGCAGATACACGATACGGAGTTACCAAGGCGGAAGTGAGTGCACGTGGAGGACTGGAT
TGCTTCGGAGCAGCAGGTAGGAGTAGACGAGGAGGAAGGGAGCCAGGCCTTTGTTCACCT
GCAAGAATACTAATACAATGGCTACAGGATGGTCTTGTAGGGCCTGATGGTACAAGCATT
TTCGGTTCAGCTACTCAAGTAAATTACATATTTCTCCCAAAATATTTTAACCACACCTTT
GCCTGTAAACCAATCTTTTTCTGCCTACTTACTGGTCAGTGCCATTATCACACTTGATTA
AACTCTTTCCTCTTGGGAATCCTACTGTTCTCTTTGTGTTCCTTGCTAAATCATCTCCCA
GACAGCTTTCACAGGGTGGTTCAAATCTCGCTGAGTAAGTCACTGGGCCTTCCATTTATT
TATTTATTTATTTATATAAATATATATATGTATATAAGCCTATATTATATATATAAAATC
TCAGCAGGGTTTTGCTTGTTTGCATTTTGCTCTGTAGAACCCCCATAGTTCTCCCACCAG
GCTCCTCAGAAGGATGTGTGTCTTTGCAGGTTGTGTTTTTCAAGGTTACGAACCAAGACA
GAACATCATGTCCATAGGGAATCTCTATGGACCTACTGGACTGGGGAACTTGGAGCCTCT
AGTGGATTTTGTGTTTGTCAATCTTTTCTATTGTGTTAGCTTGGCCACCATCCCTGAAGG
CAAGTAGCCTTGACATTGCAGAAGGCCTGAGGCTCCTGTGATGTTTAGCACTGGGCTCCA
AACACCCTTGAGGACACAGTGCCCCTCCAGGACCTTTGACACCTGGAGATCTGAGGACCT
CTAAATTTGATGTTCTGTACCTGTGGGCTGGCCCCACACATAACCCTCACCAAGTCCTTT
CGGTATTACAGGTGTATCTTGAAGCCACGTAGCCATCCATCATCATCTTACTGTGGTAAG
AGCCTTTACTTTTTAATCTGTCCACACCTAAAATAAATAGTGTACCTTCCTTTTCAGTTA
CTCTCTATAAGTTGGATTTAATGAACCCGCAATTATAGGGTATTACATATTAAAACTCTT
AACTTAAATGGGATCAGTCAGGTGTAGGTAAAGATCCCAGACCTGCTGTTCATAACTCCA
TACCAGTCAGTAAACCACCTCAATAAACCTGGGTGCTGAATGGAACAGACACATCAAGGG
CAGGCACCTAAGTCCTCTGCAGTTACATAGAGAGGGTGGCAGTATTTTCTGTCTTCTAAG
GGTAAGGACTGGGTAAGGTACAGAAAGGACCAAATTTTCAAACTCAGTAGAGAACAAAAT
ATCGGCATTAGCGCCTGCCCACTGGATTTGTGGACTGAAGACAATGTAGCTTTGAGCATC
GTTTAGGGCCTAGCAAATAATTTGTACCCCCCAAAAAAAAGATACTTTTTATTTTTTAAA
GAACCTTGAATTTACATAGGTTCTATTATTAAAATAACAAGATTTATCAGAAGACAGGCA
TGTGTGTTATCTAAAAAAGAACACGTTCTCAGCTCTAGGAGAATATCTCCTTGTTTCTTA
GGTGTTGGGAACAGGGAAAACAATGGCTCTGCTGTTGACCTTAAGATGTTTTCTATCTGA
CCATACTGGGCTTGGGCTAATAACAAAGCACTCTGCATAGCACTGAACACACGGAGTCTC
TGGACTGGGCAAAGATGTGAACTGAAAAGGTACAGAGAGCTGGAGAGGAGTTACTTTCTA
TAATTTGGATTTAATCAACCAACAACTATAGGGTCCAAGGCCAGCCTGTGCTATATAACA
AGACTGTAGGGTAGAGGAGAAGAGGGCCAGTATTTGAAGCAAATGAGTTCACTACATCTC
ACCAGGGTCTTAGGCAGGTGTCATTTCTTTGCAGAATGCAAAGTCATTACTTCCCCCAAG
TTGCAGGGTGGAACAGAGGTGCTAACCTCAAACTCAGGCAAGTTGAAGAGTTGGTTTAGG
GGGAAACAGGTCTGGAAGAAGGGTGGAAGCCACTTAGGGACATGTTCACTATACCCTGGA
AATTCCAAACAGTCCTAGGGCTGAGCCATGAGACCAAGACCAGTCTCTGTCTCATTTGCC
CCACATTCCCAAGGACACAGCAACCTCAGTCTACAGCATGCAGGTCAGTGTAGACAATTG
AGGGGTAACTGTGGCACGTGCCTATAATCCCAACATTCCAGGTGGCTGAGGCGGGAGGAT
CCTGAGTTAACATCCAGACTGGACTACATACAAAAATAAGTGAGTAAGATTGGGGGCGGG
GAGTATAGAATGTATCGAAAATCTTCTACCTTGGGAGGTAGAAGCAACTTTGCCCACATA
AACTGTCTTAAGCAAGGAAACAGGGAAGTGTTACCCCTAAGGGTCCTGGGTTCTCTAAAA
CCAAGTGTCAGCCATTCTCTTGGGTGGATTTCTGAGCACTGGGCTATACTGTCCCCCTTG
GGACTTTGCATGGCCCTAGGACCTTAGAAAGGGAGGGTATTAATATTACCAGGACCCCTC
TGATGTTCAGCACTGGGCTCTGACCATCCTGAGGACATGGTGCCCCCAGGGACCTTTGAC
ACCCTGGGGTCTGAGGGGCCCTGGCGACAAAGGGAGTGGATGGGGAAGCTGTGGTCTTTG
TGAGTCTCACCAGCCTTTCTCCTCTCCCTCCTGCCAACAGACAGAGGCAGTTCCTTCAGA
CAACCAGGCTTCCCTCCAGGTAAGCAGAGAGCTGCCTAAAGTGCTAGGACAAACAGCTCA
GTTTAGACTCTGTGCTGTCAGTGTGTATGCTTGCGGACCCCCTTGATGTCCAGCACTGGG
CTCTGACCATCCTGAAGACATGGTGCCCCCAGGGACCTTTGACACCCTGGGGTCTGAGGG
GTCCTGACTACAAGGAGGAATGAATAGGGGGGTGCCATGGTCTTCGTGTCCCTTGCCAAC
CTCTGTCCCCTCTCCTTCCTGCCTATAGGTGGTTTCTACAAACATCCTACTTCCCTTCAG
GTAAGAGCAGAAAGACTGTCTGGAGTAGAAGTCTAATGCTAATCACATGAACTTGGTTTA
CACAATTAGACCAGATTGCTAAGAGACATCTCTGTCATGCCGCTCTTGGGAACCCCCATG
ATGTATATAGCACTGGGCTCTGACCACCATGGTGATATGTTGTGCCTCCAGGACCTTTGA
CATCCAGGAGTCTGAGGGGTTTCCATTCTAGGGGGATGCTGGGTGGGAGTGTAGCCCTTT
GTCACCTACCAGCTTGCCCTGTGTCTTTGCAGCCTCTGCGACAGCATTGCTTCTAGCCCT
CTTGCTATTCTTACCTTGAGACTGTGAGGGCCATGGCTGAGAGAGTGCTGGTGCCCACCC
AGATAGGCCGGGGGGACCGCTACTACACATACACGGAGTTGTTGGCTATCTCACGGCGTT
TCAAGCAGAACCCCAATGAGCTCATGGTCACCTGGATCCTGCGGGTGTATGACCAGGGAG
GCCCTGCCCTGTCCCTGAATTCTGGGGAGCTGGGGCTGCTGGGTGACCTCACCCATGATG
CCATCTTTAACTACCGCTGCAAGGCCCTGCGGGGGGCTGGCTGCCAGACTCTCCTGAGCT
GGCTGCTGCAGGCCTGGCGTCAGCGTTGGGAATCCTCCCTGCATTTTGAGGCCACCGAGT
TACCCTTCAGGCCCTGGACCACCATGGAGGAAGGCATCCAGTTGGTGCGTGAGCTGGGCA
TGATTGAGTGGATCTACCTTGACCCAGAAGGGCCCGTGGACCTGGCCCCAGAGGATGTGG
CCTTCACTCAAGGCCTGCAGCGGCGCCTGCTCACAGCAGCCCCCTCTGAGCTGCGGCTTT
CACTGGTCAGCCTGCTGGTACGTGGCATGACAGTGTTGGAGGCTGTGATGGAGATCCAGA
CTATTGCTGACGTGGGTCTGCTCTGGCGCCAGAGCCATCCAGGCCGCACCAAGCTCATGT
TGGGGCCCAACCCAACTCGTAAGGACCTCCTAGGCTGGCTGCTCAGCCACGGTGTACCCC
GGGAGCAAGTAGACAGACAGCCCACCAAGGTACTCCTAGAACTCTACATCAAAGAAGCCA
AGCGCAGTCGCGGCCACCCCAACTATGGGCTGAACGAGGAGCAGCCCCCACCACCCCCTT
ACTCCGACCAGGCCTGTGGGGAAGAGCAACCGGTGCGTCATGACTAAGTCCTGGACTGAC
GTCAAGAGGACACTTACACCCCAGGGTCGAAGGTGGGAAAGTGAATTGCAGAGAGGCTGT
CTGTAACCCAGGTGACTAGGAAGCAGCTTGGGGAGCGCCCAAGTGGACATTCCCATCCTA
TAGCACTTAATGCCAAGCTCGGTGGCCCCAAAGAGAAGTGTGCATGTTCCTAGCCACACC
ATCCATATGGAAAGTGAGCCACAGGTGGCTATTGGTTGTGAATCTAGGGTGCTTATGGCC
CTAGAATTAATCCCCCTGAGTTGAAGCTTAAGGCCATGCTAAGATGTGTGGCCACATCAG
GGTCCCCACCCCTCTGCCTCCACATGGACCCCAAAGCACTACATACAGGCCATCTTGAAT
TTTTTACTTTTTCAATGCAACACTTACATAGTATTTTAGGTATAGGCCGTACTTCCATGG
CCTTTTACTGGATGTTTGACACTTTAGGGCCAGTCTCCCTAGTGTAAAGGCTTAACATTG
CAAACTTTTCTAATGCAGCATTTTTACTTTATATTTTATTTTGAGCTTATGTGACACTTT
GGTTTTGGGGAGAGGAGAACCCCCTTTTGTAAAGATTTTGCTTTGGGGACCTTGTCCCCG
TTTTCTTTTAACCATGCCCTTCCCTTTTGAAGCACCTTCCAGCCGGGTCTGGTCTCCCTG
GCTGCACAGATGGCCCCTGGCCAATGCAGATCTGGATTTAGTGGAGGGGTGAGGTGGGCA
GCCCTGGAACTTCTGCCTTCGTGAGTTTCTATTAAATGGCTGGTTCATTGCCCTCTGTAG
GGTGTGCTGTTTGATTCGGTTCCGGCGTGGGTAGAATCTGGGTGATGAGCTGGGTCCAGA
GCAGGTGAGGCACAGGCGCACTTGCCCACCTTTGGCCTGTTTCCAGAGGATACTCCAGCG
GTCTGGTGAGGAAAGGTGGGCTGGTGGGGGCCAGTCACAGCCACTGGCTGGCCTTATCCC
CTACCTCAGAGCCTGCAATTGATCAGACCCTCTAGTTCAAGCTGTTCTTGGATTCCAGGG
TATGCTCCTTAGCTTCCTTAGGCTCTTAGGTCTTGATGTACCTCCCCCAGATAGGAAACC
TCTCAAGACAGGGCTGGGGGGCTCTGGGGAATGATGAACACAAGGCAATGGGCATGGGGC
TCCAGGTGATGGCAGTGACACAGTGGCTGCTGGTAGGCTGTTCCTTAGTAGGAGTTAAGC
CCTCCCTCAAGTGTCACCTGGGGGGCTGGCAGGCTCCCTCAAGTGGAGGGATCTCTATCT
CTATCTGTTCTGCCACCATACCAGGGTTAGAGTTGCTTAAGGCAATTGAGTCCTGTGTGC
TCTCAGGCTACAGGTTCCCACCTGCACACGTGCTTATTGTGAGCCCCGACACCTGTATGT
ACAACACCTGATTGCAGTGTCCAAGCAAGCATAATGCTTGAGGCCCACCCAGCCTTCATC
CCCACACGCGCATGAGCACAGTAAGTGACAAGCCAGAGCAGCAAGTGAGCACACGTGTTG
GGATCCAGTGTCAGCTCGGGGTATTTTTGTGTCTATTCATCCCCCCTCACACAGTCCCTC
CCAGGGCCCGCAGGCATCTGGGCCTCCAGGCCAGAAGACCAAGCCCCAGGCTTAGCACGG
CCAGCACAGCCACAGCTCCGGCCAGCAGGGGCACCGTGGCTGCAGGAAGAACATGGGGGT
TGTGAATCCCAGGCCTTGGGAACTCCCCACTCCCACCCCAGCGTAGAGGGCTGTCACCTG
GGGGGCTGGCAGGCTCATAAGAACCATGGCAGGGGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 2531..2574, 3821..3878, 4300..4338, 4588..4619, 4892..6598
4952..5803
BC060592.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved