Mus_musculus Locus Rps16
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps16
Mus_musculus
Rps16
7
SNORA40
1857..1981
4045
CAGTGACTTAGAACAATTCTGGGGTGGGTACTATGGAAAAGTTAAAAGCTGGTTTTCCT
CAGGTTGGTAGGCTGGAGAATTCTGTGGAGTAAACACATAGAGCGGAGGGTTTAGAGGAG
CATTACGGTCACTTGGAAGTTGGAAAGATGGTGGTTAAAAGCACTAACTGCTTTTCCTAG
AGAGGACCTGAGTTTGGTTACAGGTACACAAGTTGGGTGTGGCTCAGACACCCTGTAACT
ACATTTCCAAGGAGATTGGAGGCCTCCCTCGGGAACCTGCCCTCGAAAAAAGTATTAAAT
CTTAAAACAAGGCTACTTGGAGGATTCTGGATAATGATCTAAGATAACTGCCCTGAAGAC
AGGTCCTGAGGGTAGTTCTCTAGGGGAGGGTCAAGCTGGGAGAACAATGTCCCTGGAGCA
GTTGCTGGGGAGAGGAGCCACCAAAGAGGTAGTTAATTTTGGCAGCGAAAGCAGGCGAAG
GCCCGAGTCTGTGAGGAAAAAAAACGTATATAAGGCACAACCAGAAGGCAAGAGAAGTTT
ATTTAGGAGAGCGCTGGAAAGGGCTTTTAAGGGGTCAGGTTTCCTGGGAAGAAGAGGAAG
GCAATTCTGGTGAAAGGCTGATTCGCGACGGGGGATCGTAAGGGCTAGGAAAGAGGGTTC
TGGAGGCAAGATTCTGAAAAGCCAGCTTGACTTAGCATAGTGGATGCGGGAAGACTCCGA
TGGGATGGGGATCCTGGGAAAGGGTGGGAGGAAGAGGGTGAGAATCGGCCTGGAGAAGCG
CCGAAGGAGAGCATCGAAGAGCAGGAATGTCTATAAGAACTGGCCGAAAGTCAAGACCAA
GGCTGCGGAAAAGCAATGGAAAAAGGAGGCCAGCCCCATCTTCCGAGTTCTGGACGGAGT
CCCCACCCTCCGGGTCCCGCACAGCTCCGCCCCTTCCCCTCCGACACCGCCCCCTCCCTT
GCCTGAAGGCGTTCCCGCCGCAATTCACACGTCCCCTCTCAGGCTTCGACGTCAGCCGTA
AAGCCCGCTTCTGTCGTGACGTAGCACTCAATGCGCCTGCGCAGACCCTGAAAAATCGGC
TGGGTTGGCCCCGCGCTTCCCTTTTCCGGTCGCGGCGCTGCGCGGTGTGGAGCTCGTGCT
TGTGCTCGGAGCTATGCCGTCCAAGGGTCCGCTGCAGTCCGTGCAGGTCTTCGGACGCAA
GGTGTGCCAGGGGCGGCATAGAAAGAGGTGGGGGTGGGGAGGGGGGTGAGAAGGCCCTGG
CTGGGTGACATGATGAGCTGGGGCCCGCTGAGCCAGGGTCCCGCGCTCACACGGCCCCGC
CGTCTCCCTCGCCCTTCACAGAAAACAGCCACGGCTGTGGCCCACTGCAAACGGGGAAAT
GGGCTCATCAAGGTGAACGGACGTCCCCTGGAGATGATCGAGCCGCGCACGCTGCAGTAC
AAGGTGTTGGGGTCGGGCATGGGCGTCCGGGTGGCGAGACGGAAGGGAAGGCCCCGGGAT
GATAGGGAGTTGAGGTGGGGGAAGGAGGATGGCTTACCTCGCGGTAGACCTTAACCTGGG
CTCGGGAAAGATGAAGTCGGAGCTGGTAAAATACATGAAAACGTGGCCTATTCTATAACC
TCGAAGCTCTCCAGATGCGAGGGGCCCGTGGCCAGGAGAATAGCACAGTGTATCCGACCT
AATTGACGATTTCTGGTCTAGAAGTATGAGTTTACAGCTCATGTGTATACTCCTAGCTCC
TTGGAGGATAGCATACTACGAGTTACGAATCCAAAGCGCCGCCGTTTAGGTCAGCATGGG
GCTACAACGTGGAACCTTGAAAAATACAATAGGAGTCCTCTGAAGTCTAACATTGGTAGC
ACTTGTATGGGTTTTTGTTGAACTAGTGGGCAAAAACTGGAAAACAAGTGCAAGAACAAA
TCCTCTTTTGCAACCCAGAACTCATTGTTGTATGAGTTTTGGTACATGTAAGAAGGAATA
TCATACCTTGCAGACAATGCATTCTAATGGTAGTGTTGATGTTAATGCCACTAGACCCCC
GTGCTTAGTCTAATCCAAGTCTGTCAGGTGACTAAAAAGGACAGTCTGTCAGTTTATTTG
AACGATTGGTGTGTGTACCCTGTGTTGTGAATTGGGCCAACACCAGTGATGGAGGTGGCT
CTAGGCCTGCCACTCGGGGAGCTTCTGGATAGACTGGTCCTAGGTATTGGACAAATTTGA
TCCAAAGAGAAGATGGAATGACCACTGTGAGAACAGTGGACCTGTCTGACCTTGCTTCCT
GTTTGGGGAAGTTCATAGTTGCCTGTCACTCCATGATTCCAGCTCCTCGGTGTCTCAGGC
CCTCTTCTGGTCTCTATGGGCACATATACATGGGACTCTGAGGGGCACAGGGATCCTAGG
ATAGGCTGCCTCCTTGATTCTGGTGATGGTGGGAACCACACAAAGGGAGATGATGAATGT
CCATGGAGAGTGGTTAAGTCAGGGTATGACTTAACTCCCTAACCCCATATTTTCCCATTT
CTCTAGTTACTGGAGCCTGTTTTGCTTCTGGGCAAGGAGCGATTTGCTGGTGTGGATATT
CGGGTCCGTGTGAAGGGTGGTGGACATGTGGCCCAAATTTATGGTAAGTCTCAGGATCTA
AGCCTATGGGTGTGAGGCAGCTCCTGGAAGGACTGGGTCTTCACTAAGCTTTTTGGTCAT
TGTGTCTTGCAGCCATCCGACAGTCCATCTCAAAGGCCCTGGTAGCTTATTACCAAAAAT
GTGAGTGAGAGCTGGTCTTTCATTTCATGGCGGGTGGGCTATGTGGTAGGACCAAACTAA
AGGTCTTGTCTATTAATCTCCAGATGTGGATGAAGCCTCCAAGAAGGAGATCAAAGATAT
CCTCATCCAATACGATCGGACCCTGCTTGTAGCTGACCCCCGTCGCTGCGAATCCAAAAA
GTTTGGAGGTCCTGGTGCCCGTGCCCGATACCAGAAATCCTACCGATAAGCCCATCTCAA
GGATCGGGGTTTACCTTTGTAATAAACATCCTAGGATTTTAACGTTCCTGTTTTTGTGTT
GGTCTCTTTTTGTAGTATTAGTGTGGTTGGACAGTGCAAGAAACTCCCTTAGTAAGTGGC
ACTAAGGAGTAATGGCTGCCTTCCAGAGCATTTGAGCTCTGTTTTTGTGTGTATACGCTT
GCTTGCTTATTTATTTATTTATTTTTACTTTTTTGTTTGTTTTTTTTTTTGTTTTTCGAG
ACAGGGTTTCTCTGTGTAGCCCTGACTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCC
TTGAACTCAGAAATCCATCTGCCTCTGCCTCCGGAGTGCTGGGATAAAAGGTGTACGCCA
CCATGCCTGGCCCCTATTTTTTTTTTTAAAGACCTGGTTTTTCTTGGCCCCTGGCTATCC
TAGAACTCAACTATATCGACTCCAGAGCTGTGCCTCCTTCTGATTCACGAGTGCTGGGAA
TAAAGGCGTGGACCACCACATTTAATCCTCTCTGGCCTTTATGGTTTGTAGAGATGGCAG
GTAGAAGGCTTAGTTTGTTTCCCTTGGGTGGAATGCATGGTGGGCAGAGCCTGGGTTTTT
ATGTTTATGGGTGTATGTAAGTGCATGTAGACATCAGAGGGCCATCTTGGATGTTCAAAT
GCTGCCCACCTTAAATTTTGTTGAAAGATTCTTTGTTACTTATGTGTATGAGTTTTGCTA
GGTAGGTGTGTATGTATGTACACCACACACCCAATTCCTGCAGAGGCCAGAAGAGGGTGG
TGCGCGCTTGGAATTGGATTTACAGACTGGTAGGAGTCACCATTTAGATGCTGAACCCAA
GTCCTCTAGGAGAGCAGCCAGCACCTTGTTTAACTTGGAGCTAAACCTCTACTAGCCCCA
AGATTTTTGAGACAGTGTGTATATACACTTGAGGGAGGCCAAAGGGCAGGTTGAACAAGA
TCTCTTACTGAAATCAGGTAGTGAGCTTCAGGAGTCTACATGTCTCTACCTCATTTGCAC
AAGGATTACAAGTGTGCAACCATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1200, 1341..1442, 2526..2622, 2712..2759, 2843..3045
1153..1200, 1341..1442, 2526..2622, 2712..2759, 2843..2985
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved