Mus_musculus Locus Gltscr2
snOPY snoRNA Orthological Gene Database
Mus_musculus Gltscr2
Mus_musculus
Gltscr2
7
SNORD23
8194..8302
10226
GGTTATGAGGATTAATCTGAGGCTTGGCAGCAACAGCCTTTCTCTACTGAGGTATCTTG
GCAGCCCCACACCCAGCATCTTCTTTAATAAAAAGAGTTAAAGAAAATTTGACTGGACTC
CGTCCCTTGGCAGTTACTATTTGGGAAGGAGGGGTGTCCTTCAATGGCATACACACTGGT
CAGTTGCCTCTGATCTAGTAACTAACTCTTCACTCATTGCTGGTACAAAAAATCCTAGTA
AATCCAGTACGTCACAAAACTACAAAGACACAAGGGAGGAGGGCATTTGGGGGAAAGAAG
GGTAGTTCAGTAGGAGTGAGAAGGCAAAGGGAAGCAAAAATGGCAAGGCACGTATGAAAC
TGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGTTATACAGAGAAACCCTCTCCCGAAAA
ACCAAACCAAGAAAGCAAGCAAGCAAGCAAGCAAACAAAAAACTTGTATAACTAACAAAA
TGGTTTGAGTAAAATTTTATGATACCGGGTAAGGTAAATTACTCAGAGTGAGAACCAAGA
ATCCACATAGCCTACTCCCTACCAACCCGAAATTGCAGGTCGAATCTCTGAATTCGAGGT
CAGCCTGGTCTACAGAGTGAGTTAACAGACAGCTAGGCTACACAAAGAAACCCTGCCTTT
TGTTGTTGTTGTTTTGTTTTTTCAAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGG
AACTCAGTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCG
AGTGCTGGGATTAAAGGCGTGCGTCACCACGCCCGGCTCGAACATTTTTAAAATAAGAAG
AGACTGAACGTGATGATTTATCCTTTTGCCAAGACGTAAAACTCTCTATGTAAAAACTAC
GCTTTATCAAGATGGTCGCAAACAGGAAGTGCGTCATATTACGTCACTCGAGACGCGCAC
GTTCCAAACCGGATATCGGAGTTAGAGCGACTAAGCTCTTCCTTTAAGAAGATGGCTGCG
GGTGGTAACAGGGACGGTGAGAAGCGCGGCTCGAGAAGCCAGGCGGACTCTGGCTTCCTG
GGGCTGCGGCCGACCTCGGTGGATCCCGCTCTGAGGCGGCGGCGGCGGGGCCCCAGAAAC
AAGAAGCGCGGCTGGAGGAGGCTCGCCGAGGAGCCGCTGGGGTTAGAGGTCGACCAGTTC
CTGGAAGACGTCCGGCTACAGGAGCGCACGACCGGGTACGTGGGGCGGGACTTCCGGTGG
CGTGGCCGTGCGCTTTGCGACCTGGTGCTAGACGGACCGGGCATCCCGGCTCGGTGTGGG
AGACCTATCAATAGTATCTTTAACAAATAAGCGTGCGAAAATCCCAACAAAGTTTAAGTT
TTCCCCTAGTTTTTTTTAAAATTTGAAACAGGGCCTCACTATGTAGGACGACCTGGCACT
CGGTATGTAGACAAGCCTGGCTCCGAACTCAAGTTTCCTCTGCCGCCGGAGTGCTGGCAT
TAAAACCTTTTGCTACAGAGTTTGAATTTCAAGTGAAAGAGAATAAAGTACGTTCACCCC
ATCGTGGTACATTTTAAATTCTGTGTGAAAGCTCCAGGTGTAGCCCATGGTTTGAGGAAG
AGTTGGGATGGGCCCAAAAAGTTAGACCCCTAAGGGTCTGTTATCTTTCCAGCATTACTT
TGGCAAATAGTCTGCATTTTTATCCTTCAGTGGCTTGTTGGCAGAGGCCCCAAACGAAAA
GCTCTTCTTCGTGGACACAGGATTCAAGAGAAAAGGTGAGGAGTGCTCTTATGAAGTTGT
GTGCTGGTGGTTCTCTGAGTCTTGCACCCGTGAGATCTGCATTGATGACATAATTTAAAG
CAAAGCACACACACACACTCTCTCTCTCTTTCTCTCTCTCTCATTTTGGAAACAGTCTTG
ATCACAAGTTTGGAGGGGAGGGGGGATCGAGACAGGGTTTCTCTGTGTATCCCTGGCTGT
CCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCACCTGTCCCTGCC
TCCCCGAGTCAGTGCTGGGTGTGGTTCATCACCACAGTCTTACCATGTATACCATATTGG
CCTCAAACTTAGATCTGCTTGCCTCTGCCTCCTGAGTGCTGGAAATAAAGGTATGCTTTA
CCACTGGAGACTAGAAGGGGCAGTCTTTAGTATAAAGAATTACTTTGAATGGCTTTGAAA
CAAGCTTGAGATGATTAAGAAAGGTGACCTGTTGTTCATTTTTGTTTGGTTTTATTGAGC
TGTATCATTCAGCTTTTTTTTTTTTTGTCCCCCTTCCCCAAAGAATATGATAGCAAGCAT
GATAACCCACAACGTTAATTTCTCTGAGTTGCAGGCCAGCCTGGTCTACATAGTGAGCTC
CAGGACAGCCAGGCCTACACAATGAGACCTTGTCTCAAAACAGAGAGAACAAGAGGATCT
CTTTTAGCCAGGAGGAAGGAAACATGTCTTGGCAAGATGGCTTTACTCCAGCAGAACTTG
GGCTGGGACCTGCTGGGACATGAAAATAAGGGCAAGTTAGGGATTGCTTTGCTGAGTGGG
GTTTTCACCAAGGAGGCAGAAAAACACTTAAAATGGGAAGCCTGGTTCAGCAGGTACTGA
AAACAAGCCAGTGCCTGGTCCAGCAGGACAGCCAGTGGCTTTGCAGAACAAGCTGGCAGC
TTTGCCAGCAGCCAGGCACTTTAGTATGCACGATGTGAGTCAAGGGGTCCTGTTCATGAA
AACCTTCTTGACAAGGTCGGGAGAACCCAGGGAAGCTGTGTGGGGACCCGGGGACGTTAA
CATCTAAGGTAATGGGTTCCATCTGCCCCACTCAGGCCAGGTCATGGAGTTTTAAATCTA
GGTTCTGTGTGCAAGGGGAAACATGGCGTTTATCATTCTGAGTTATGTTCATTTTTGATT
CAGTAATAGCTATGCTTTGTTTTTGTTTTGAGACAAGGTCTTCTTCTGTACGTAGGCTAC
CTAAAAGGTCACGGTGTGGCCCAGGCTGGCCTGGAACTTAACGTCCTCCTACCTCAGCCT
CCCAAGTGCTTGGATTACAGGTAGGAGCCAACTGGCCAACCTATAGCGTTTTATCCATAA
AAGAAGCTAGCGTTCACTTTTTGTTTTTACATTCATTTCTAGTTAGGGTGTGCATGTGCT
TGAATGAGCGCACACCATCTAGGATGTGCCCTGGCATGTGTGTGGCTGGAGGGTACCATG
TCTGAGTCAGTTCTTCCCCCATGATCCTGGGATTGGCCTCAGGTTGCCAGGCTTGGTAGC
TAGAGCCGTGCCTCTGCCTCTGCCTCTGCACCATCCTGCAGTTCAGTATTCAGCTTTTTG
TGGCTTGTTGCTGCTGCTTTTATTATTTTCAGTGCTCGGTGGAACCCGGGGCCTTGTGTG
TGTTCCTCAGGTATTCCTGTGTCCTGTTAACTTTTTGGAATTAGGTTCTCTCTGTTTAGC
TCAGGCTGGCCAAAGACTCAATCCTCCTGCCTCGGTCTCCAGAGCTTTAGTGTTACAGGT
GTGCACCACTGTACTCGGCCTCCTTAGTGGGTTCTGCAGCATCTGATGTTCTCCTGATGG
GCTTTGGAAAGTAGAAAGCAGAGTGCTAAGAGAGGGCCACAGCCTGCGTCTCAGTCCTCC
TGGGTGCCTGCCCTCTTTCTTCCCTGTTAGTTCTGAGGTCCTTTCCCTGCTTTGTCTATG
AGTCCTTCCAGATAGGTCTGTGGGGACTTAGTCCCCATCACAAGGCCTATCTCCTGCTTG
CCGAGGCTGTGGTGGATCGGATCTGGGAGTCTGGGTTCTTTTTTGGGTTTTCTTTTTTGG
TTTTTTCGAGATGGGGTTTCTCTTTGTAGCCCTGGCTGTCTTGGAACTCACTCTGTAGAC
CAGGCTGGCCTCGAATTCAGAGACCAGCCTGCGTCTGCCTCCCAAGTGCTGGGATTAAAG
GTGTGCGCCACCACGCCCGGCTTGGGACTCTGGGTTCTTAATCTAGGATCTTCCCTTGTA
GGTGAACAGGGTCAGTCTGGGAACCTTAGGCTGTGTTACCTAGGTTGAAGGCCATCAGGC
CCTGGTTGACCTGAAGTTGGGGATTGGTTTATGAAGGGAGGGAAGGAGGCCTAAGGTAAA
GTCTCTTCCCCTCTTTGTCCCCTGCAGAACCAAGAAAGAAGAGGACCTTGGTCCAGAAGA
AGTCACAGCGTCTCCAGAAACCCTTACGGGTTGACCTTGCCCTTGAGAATCATTCTAAGA
TCCCTGCTCCCAAAGAGTGAGTCCTTCCAGCCCTGCCCCCTGAAGACTGTAGGGAGATGG
CGTGGTGGAGGCAGTTGAGAGAGCAGACTAGAGTATAGCTGGGTCTCTGGAGAGTGGCTT
AGAGGATTCAGCCCTGGCAGCAGGGTAGCCTGAACCAACTGGGACTATGGGGTAAAGAAG
CGTCAGCCCTAGGAGAGAGAGGACAGGCTAGCAGGCTCCGCTGCCCTGAGGGAGTCTGCG
GGATCTGGTGTTGTGAATGCTCAGATCTAAATGTAGTAGTGGGTATGAGGTTCTGTGCTG
AGCCAGTTGACAAGAAGGCTATGCTGAGGCAGGCAGGAGAAAGGCTGCTGAGCAGCAGGA
ACAGCCCAGCTGGGAGGGGCTCATCATGCTCAGCTGCTGCCTTACCAGTTGCCACTCTTT
CCTTACTCAGCATCCTCGCACATCAGGTCCCTAATGCCAAGAAGCTCAGGCGAAAGGAGG
AGTTATGGGAGAAACTGGCAAAGCAGGGCGAACTGCCCAGGGATGTGCGCAAGGCACAGG
CCCGACTCCTTAGCCCTCCCACACCAAAGGCCAAACCTGGGCCCCAGGACATCATTGAGC
GACCCTTCTATGACCTCTGGAACCCAGACAGTGAGTGATTCTGCTCTCTTGCAGGTGGGC
ATGACTGGTGTGGGCAGTTGTCCATGTTGTACACTGACTGTCCAAGAGTGTGGCATCCAC
GGGCATGCTCTGTGGATGTTGACAAACTTCCAGCAGGGAGTCTGAGGTCTTCAGGGCCAT
CCTTTCCTGCTTGTGGGGCTCCCTTCCCAGTCTTCAGTCTCCCCCATTTGTGAAGTCCCA
TCGAGATGTGGTTTGAGGCCCTGGGAGCCTGAGCAACTTCCCTTGCCTGGATTTCAGTGT
CATTTTTAGCAATGGAGGGACTGGTAGGGTCCCTGGGGCACAAACTCCCTTCTCTGCTAG
AAAGCTCATTGCAGTTGCTCTCCTCTCCCTGCAGACCCTCTGGACACGCCTTTGATTGGT
CAGGATGCATTTTTTCTGGAACAGACCAAGAAGAAAGGCGTGAGGGTAAGTTTGCATAGG
CAAGCAGTGGGGTAGGGAGGGCAGCTTCTTCATGGTCCCCATGCCTGTCATCCTAGTGGT
CTGTGTCCCTGTCCTAGCTCCCATGATGACCGACCTTGGGAAGGTGACCTTACCTCAGTG
CCTCCATTCTTTCCTCAAACTGTAGAGTGTGGGTTAAAGAAGAAATGTCTGAAAACAACC
CAGTGCTCACTGCTGGCGCTGTAGGTTGGAGGTTGGTTTGTGGCCATCATCTTGAGCTCT
AAGTGTTTGCTGCTGTGGGCCAGGTCCTATGGAATCTTAGCACTTTTGGGGTGATGTGTT
CTCCCTGTGGGTCTGGAAGAAACCTTGGCCTTCACATCCCTGTGTTAAGTGTCTCCAGGA
AATGAGAGCTTAGGAGCCAGGCTTCAGGGAGGCCAGGAGCCAGCACTGGAGAAAAGCCCC
TGGGGCTAGAGACCTGGAAGAGCAAGGCAGCCATAGGCAGAGGGGCTTAATGCACAGAAG
CTACGAGGCAGAGCAGGGCCAGAGACCTGTGCAGCCACGGGTATGCAGTGGGCCCTGAGT
CACCATGTACGTACGGGGAGCAAAGTCCTAAGACAGTAGTCTCAGAACTCAAGGGACCAG
GTTGGGGAAGTTTGAACTAGTAGGGAACCACTTAATGTAGGGCCTATACCAGGAAAAAGA
CTAGATGGGGCGGGGGGGGGGGGGGCAAGACAGCTTGATGTAGAGGGCGCTGGTCACCTG
AGGTTTCTGATGTGAAGATCTGGTCTTCATGTTCTCTGGGAACTTTTGGACCACGTGGGC
ACCAGAGTTGTCACCCATACTTTGCTGTGGCAGCGGAGGGCCTACAGCACAGCCAATGTG
GCAGTGTGCCAGGGTATATAGACCCAGCATGTCACACGCTCCCCCTCCCCCAGCTGAGCA
AAGGTGATGCACCCCCTTTAATCCCAGCACTCCAGAGGTGGGAACAGAAGGCTCTCCAGC
CTGGCCTTCAGAGTGAGCTCCAGGACAGCCAGGGCTATGCAGAGAAATCCTCTTTCAAAA
AGGAAAAGCAGATGCTGTCCCATTTCCCTCGTGGGTCTTGTGGCCTGCAAAGCCCTTCCT
GTGGAGGGATTGCTCATTCCAGGGTCAGGTATCCCCTGTGCAGGGTGTGAGGTCCTGGCC
TCATGAACCCTGAGTCCCTGCACCCCAGATGGAAGAGCTCCAATGTCTGGCTCCTGGTCC
TTTATATCTCACAATAAAACTGTGAGATGGGCTGGTGGGCAGGTAACAAGGGACCTTTGC
TCCATGGGGAAGGGCCTGGTATCAGTGCCTCCCATGGTGGAAAGCTGAGCACGGAAAAGG
GTGTAGGGTGAAGCCTTTAGTAAGACTCAGTTCTCTGAATCCTAACTTGTCAGGCCCCAC
GTCTTAACAGTCTCACACTGGTCTTGGGGCTTCAGTGTAGGCATTTTAGGGGTACACTGG
TGGTTCTTGGCATGGAGTTCATCCTGCCTCCCTGCTCTTGTCTTCCTCCAGCGGCCACAA
CGCCTCCACATCAAGCCTTCCCAGGTGCCTGCAGTGGAGGTGATTCCTGCAGGAGCCTCC
TACAACCCAACCTTTGAAGATCACCAGGTTAGTGTGCAGTGGGTTCCTGGCCTAACCCAG
TGCAGGTTTCACTGTCTGGAGTCCTCGCTCCCATTTACCCTCCCTTACCTCAGGCCCCAC
CTGCTTCCTTCCCTGAATTTGTCTGTTCAGGGACCAGACCATCTAATCAGAACCCAGCAT
AGGGTGAGGGTGAGAGTAGCTCAGATGTCTCCACTGGGCGTGTGTAGAGGGTGGAGCCAT
GAGCTGGATCAGCGCTAAGACTCAGGCATGGGGTAGGATCAGAGGGACATCCCTGATATT
AGATTCACCCCAAACTCTCACCTCTGCCCAGGCCCTGCTTCGAGAGGCCCATGAGGTGGA
GCTGCAGCGTGAGAAAGAGGCAGAAAAGCTGGAGCGACAGCTGGCCCTGCCCACCTCAGA
GCAAGCTGCCACCCAGGTGAGCCCCATCCACCGCTTGTCACCCGCCTGTAACCTCACCTG
CCCCCACTTGCTGACCACCCTGCTCCCTAGGAGTCCGTGTTTCGGGAGATGTGTGAGGGC
CTGCTGGAGGAGTCTGATGGTGAGGATGAGCATGAGGCAGGCCGTGCCGGGCAGCCAGAG
GCTGGTGATGGGACCACCGAGATCTCACCCACTGGTGCTGCTGGTCCTGAGAAGAGGATG
GAGAAGAAGACGGAGCAGCAGCGGCGGCGGGAGAAAGCTGCTCGCAAGCTGGTGAGCACC
CTGCTCTGTGACCCTTGTGGCCACACAGGGCCCTCGGACAGAAGTGGGTGACAGGGCAAA
CAGCTGTCGAGTGACCCGATACCAGTGCCATCAAAGGAGAGGTCATGGCTTTGTGGGCCC
TGGGTGAGGAAGGCCCTGGGCAGAGTGGCACTAGGCTGAGCTCTTACCCTCTGTCCACAG
CGGGTGCAGCAGGCTGCACTGAGGGCAGCCCGGCTTCAGCACCAAGAACTTTTCAGGCTG
CGTGGGATCAAGGCCCAGGTGGCCCGAAGGCTGGCAGAACTGGCACGCCGGAGGGAGCAG
CGGCGCATACGGCGACTGGCAGAGGCTGACAAGCCCCGAAGGCTGGGACGGCTCAAGTGA
GGCACAGGCTAGGGCTCCAGGAAATGGGGGTCTGCAAGTTATATCATGCTTTTTTCTTGG
CTCTGTGAGAGCCAAATCCCTGAGTGTCTCAACCCTGTGTTCTGTAGGTACCAGGCTCCT
GACATTGATGTGCAGCTCAGCTCTGAGTTGTCTGGCTCACTCAGGACACTGAAGGTACTT
GCCATGAGGGTAGCAGAGTGTTATAGGGACCCTGTGCCCAGTGATGATAACCATCCTTGC
TCCCCGTGCCTACTCGGGCTGTGGGCGACACCATGGCTGCCCTGGGCTGGGCCAGTTGGG
CCATTGCCTGGGGACTGAGGGCACAGGGTCAGGGTGAGGTGGGGAGGGCAGGTGCTGGTG
TGAGTTTCTGACCCTCAGAAGGCCTTTTGTCACAGTCTCTTGTCAGCCCTAGTGAGTCTC
CTCAAGCTGTGCTGGGGCCTAGCCTGGCTTTGAGGTTTCCATTTTTTGCAGTTGTAGCCT
CTGTCCTCTGAGCCTAGCTAGGATAGCACACATTGACTTCAGTATAGAGCCCCCTGGAGC
TCAGCAGGGTGTAGCTGGGGGTACTCTGTGGAGGCTTTAGGAAGATGCAGAGCTCTGTCT
GAACCCCAGTGCTATCTAGGACCCTGCTAAAGTCTCTCTGACCCTCTGTCCCACAGCCAG
AAGGTCACATTCTCCGAGACAGGTTCAAGAGCTTCCAGAAGAGAAATATGATTGAGCCCC
GAGAACGAGCCAAGTAAGATCTGCCACTGTGGGAAGGATAGGGGTGGGGTGGGGGGGTGG
GTTGAGACACTTCCATACTCCCCCCCCCAACCCCCTGAGATAAGGGATGCTCATCACATT
TTCCCCTTCCCCAGGTTCAAGCGCAAATACAAAGTGAAGCTGGTGGAGAAGCGGGCCTAC
CGTGAGATTCAGTAAGTGAGGCCCACCAGCATGTGGCTGGCTGACATTCTGTGAACCATG
GTCTACCTTGCCCCGTGGTAGCTTAGCCTTCCTCCCTTTTGAAAGCTGCCAGTGTCAGGC
CCTTCCCAAACCCTCTGACTGGTCAACCAGTGGGCGCTCAGGAATCTAGAGTAGGGGTGA
AGAGGATGCCTAAGGGAACCAACCAAAAGTCTCAAATCAGAAGGGGCATTAAGTGAGAAA
GGCTGTGGGGTGCAGCTGTCCGCTCATCCACCTCAACTCTGCCCTCTGTCCTCAGGTTGT
AGCTGTGCAGATGTCGGAGCCCCGCCCCTCAATAAAGTTCTGTGACCAAACGCTGGGGTC
TTGTTATTTTCTTCTGCCCCTCCTCTGCTGCCCAGGTCTTAGCACAGCTCCTCTCCACCA
CAGTCTGCCTTCAGTGCTGAATATGTGGAGAGCACAGCTCTATGAACACTCGATCACTGA
GCCACACCCACAGCCCCTCACTGGGGGATTCTAGGCAGGGCCTCTACCACTGAGCCACGC
CTACTTCTCTTCATTGAGCCATACCCACTTTCTGTGGATCATGAGTTTCTTCTTCAGTTC
CTTCAGATCTTTGCTCAATTTTCAGATCTCACTGTGGTCTCTCATAACCTGTGTCCTATT
GTAAGTTGTCCTAATACTCTCTTGTCCCTGGTTGCATCTGTCACTCTTGGCATTCTATTT
ATCTTAGAACTTCCGTTATTTTTGTAGTTTTTGCTTGGGTGGGGTCTCATGTAGCCTCAT
ACTTTATGTAACCGAGGGTTACCTCTGATCTTCCTGCTTCCTCCTCCCAATTCTGGGATT
TCAGCTTAACACCACCACACTTTGCTAGTGCGTATAATTGATACAATTAAAAAAATATTT
ATTTTATGTATATGAATACACTGTAACTGTACAGATGATTGTGAGCCATCATGTAGTTGC
TGGGAATTGAATTTGGGACCTCTGTTGGCTTATTATATCTAAGTACACTGTAGCTGTCTT
CAGACACACCAGAAGAGGACGTCAGATCTTATTACGAATGGTTGTGAGCCACCATGTGTT
TGCTGGGATTTTAACTCAGGACCTCCCGAAGAGCAGTCTGTGCTCTTACCTGCTGAGCCA
TCTCTCCAGCCCAATTGATGCAATTTTAATTTCCAACAGTGTTTGTAACCAGTAGGTCAT
ATATCCAGATGTCACACACTTCAGACTGGAATCTATAAGACCTTCATGAAGCAGAAAAAC
TAAGTGACTATTCCAGTTAAGTGTCCAAGATCCAAGCATTTTAGGAGATCGGGGTCCCTC
TTCATTTCCTGTTTAGAAACACCTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1234, 1710..1774, 4167..4275, 4690..4889, 5254..5324, 6831..6926, 7231..7335, 7410..7610, 7800..7975, 8087..8153, 8636..8712, 8834..8890, 9175..9226
1011..1234, 1710..1774, 4167..4275, 4690..4889, 5254..5324, 6831..6926, 7231..7335, 7410..7610, 7800..7975, 8087..8153, 8636..8712, 8834..8890, 9175..9178
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved