Mus_musculus Locus Rpl32
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl32
Mus_musculus
Rpl32
6
SNORA7
1634..1773
5236
GTATGTACCACATGCATGTAGCGCCTACAGAAAAGGGCATCTGATCCCCTAGGGCTGGT
GTTAACAAGGTTGTGAAGCAACGCTTGGTTCCTGGGAACTAAATGCCAGTCCTCTGAAAG
AGCAACAGTGCTCCACCAAGCCACCTCCCCAGCTCAGGTTTGGTTTTATTTCCTCCTAAG
ATTATAGAGTTTTCACAATGATCTGTAAAACAAAAGATAAGCAAAATAGACTAAACTCGA
CCTACCTCTGCTTCCCAAGTGCTGTTATTAAAAAATGTGCACCACCACACCCAGCCAATA
GACTATTTTCTTAGCAATATTATCAACCTATCACTTTTTTTTTTCCGAAACAGGGTTTCT
CTGTGTAGCTCTGGCTGTCCTGGAACCCTCTCTGTAGCTCAGGCTGGCCTCGAACTCAGA
AACCCGCCTGCCTCTGCCTCCCAAGTGCGGGGATTAAAGGCATGAGCCACCACCGCCCGG
CTAACCCATCACTTATTAATACATTAGGTACATACCATAAGTAGAGAAGATTTAAACATA
CAGAAGTCGCGAGGAGGCTCAGTAGCACTTCATAAGCAGGGGTTTGCACATCTGTATATT
AGGAAGTTTTAGGACATTTGCTCAACCAACCGCCTAAGGATCTTCGAAGAGTCTCTGTTT
TGCTACCTCCCAGCCTCAAGGAGGCACCCTCGGGAACCAACAATTTAAAAAGCTATTGGG
CTTCCACTTAGGGCGGAAATAAATGCCCACCTAGCAGGTCTTAGCTCAAAAAAAAACAAA
AAACCCAAATTTCTTAAGTAGTCCCAAGAGAAAAATAAATTTTAGTTCACTCTAAGATGT
TAATGTCTACTACAGAACACTAGTCCACTAGGGTTTTTTTCAGTATCATTTCTCAGGCAC
ATCTTAGTTTTCTTTAGAGGACCCAGAGCCGGAAGTGCTTCCCTTTTCTCTGCCAGGACC
TAAGACTCCGTCCCATCATACCTTGCGCGCCGCCGCCGCCTCTTCCTTCTTCCTCGGCGC
TGCCTACGAGGTGGCTGCCATCTGTTTTACGGTGAGTCTGTATCGGCGGCCATCCGCCGC
CCGCGGCTTCGACGGGACCCCGTCTCCGGGTGGGGAGGCCTCGGCGGCGGCCTCCGCACC
AGCGTGGTAGTGGCGAGCGCGCGCGGGCCTGGCCACTGGCGCTGCTCCGGAGTCTGCCCG
GGGGCCGGCATCGGCCAGGGCGGGCTTGCTGCCATGCGGCCCGAGAGTTTCGGACGGCAC
CCGCCGCTTTCTGCTTAGCTTGTTAGCAGCCTTTTTCTGCGGCGAATCCGAAATCTTAAG
TCAGGGAGCTGCCGCCGCTCGCCAGTGAGCAGAAATGCTTTCTGAAGCGCAAGCCCGGCG
GAGCAGGTTGTCTGCGCGGGGAGCAGAGAAGGCACCCTTTGGTTGGTGCTCTGAGACGAC
CGGGAGGGACAGACGGACTGGTGGCGTGTTAGGAGTGCATGGTGGCTTTGCGTATTTAAG
GGCGCAACACTTCAAACATAACGAAGCTTAGTGGAGCGGGATTTGCCGCTCCTTCGCCAC
CAGAGAGACCTGGCTGGGGTTCTGTAAGATCGGTTGCGGTTCTTTGAGGTTCGGAGTGGG
TGAGATGAACCACTGACCTCTTGGGATCGCGTCTGGAGAGTAGCTAGTATTCTTCCAGCT
TCGGAAGCAAGAGGGAGAGCAAGCCTAGCAGAGGTACCCATTCCATTCCCAGTTTGCTCG
GTAGCTGGTGATTGGAAGACACTCTGCAACATTACTCACTGAAGGCCTGAGACGCAGCCC
CACCTCCCAGTTTCTTTACTAACTTGGGTCTGACTTTTGTCAAAAGGCATCATGGCTGCC
CTCCGGCCTCTGGTGAAGCCCAAGATCGTCAAAAAGAGGACCAAGAAGTTCATCAGGCAC
CAGTCAGACCGATATGTGAAAATTAAGGTATGTGGTTCTGGGGTGGGGGTTAAGACCTGA
GCACACATTTCTCGTTATCGCTTGTCTCTGCATTTTAAAAAGTTCATTTTAAAGATGACA
CTTTGTTTTATATTTATGCGTTTGAAGGGCAGGGAGAATCACTTTAAGGAGTTGATTCTC
TCCTTCCTGTCTTGTGGGTCCAGGTCAGATTTAGTTTGTCTGACAGCAGGCACTTTTAAG
TCATCTCTGCACCCTGACCCTGTATTTTAAAGATCTTTGGGGTTTTGTCTGCACACCAGG
CACATGCATGCATGGAATTGAACCTCTGGAAGAGCAGCCAGTGCTCTCAACTGCTAAGAC
CTCTCTCTGGGCCTGCAGATCACCTGTTGGCTGGATGGGCATGCACACCCAGCAGTTCAG
CAGTTAACTGATCCCTCCTCCCTACTTAATTGCAATGGAAGATGATGTTGAAATTCCAGT
GCAAGTGCTAGGGATGGAGCCCAGGGCCCTGTGCATGCCAGGCAGACACTGCTAACTGAG
CTACACCTCGGCCTTTGGTGTGTGTTTTATGACATGACCCCCTTGAATTCTGTCCCCTTC
CTGCACACACATACAAGAGCTGCCAGTTTGCACAGAGACTAACTTGCCTGTGTGTCTTCA
GCGAAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTGCGGAGAAGGTTCAAGGGCCA
GATCCTGATGCCCAACATCGGTTATGGGAGCAACAAGAAAACCAAGCACATGCTGCCCAG
CGGCTTCCGCAAGTTCCTGGTCCACAATGTCAAGGAGCTGGAGGTGCTGCTGATGTGCAA
CAAGTGAGTTGGGCCCCTGGCTGGGAGTGTGCCTGCCTCCTGTGAGACTGAGGCCACTGC
AGTGGGCATGCTTATGAGGAAAGAGGACGTGTTCCCTTGGTTGAAGCCTGAGACTGGAGA
AGAAGGTCTTTTTACAGTGGGTGTTCAGTGTCCTTTATGGTCCTGTGTGGAACACTGCTA
TAGTGTCATGAGACTGCAGGGGCCTGTGTCTAACCTGGGACCTAAGCTGTGCTTGGCTCT
GCTCTGACGGGTGGATTTGCAGAGCAGCTCAGGTCTTTTGGGGCTGAGGTAGAGAAAAAG
TCTCCAGGCACAGCTGTAGAGAGAAGGTTGTGGGGTATTCTGGGTACTTTGAGCAAGTTA
CAACCCTTGGTGACCTCTGAGATGCAAAACCAAGGCCTCTCAGGAAATACTCTTGACATT
GGATATGAGGGTGTGATGGGAATAGTTTATTTTTCCCAAGTAAACTAGGACTGCAGAGAG
TGTATGTGTTCGGGGTTATAAGGATTTGTTTTCTGAGGTGGTTGTCATGCAGATGGAGGA
GTCCTATGGGGAGATTATGTTGTGCATTTAACCAGGCCTTGAAGTGCTACAAGTTCATTT
GGAAGGATGGATGCAGGAGAGAGAATGTGTGTTGTACAGCAGCAGTCCATGAGGCAGTGT
TGATGGTGCAGTGTTATGGGGGCTGCATTTCTAATGGGTACATCTGCCCCAGGAGAGCTG
CTTGGCCTTGTCAGACCCTGCAGGTGCACCGCTCACTGAGTTCTGTCTCTGGGCATTTTC
CTCTGTATAGCTGGGGAGCAGGGCAAGTTGGAGGGTAGTTACAGAAAAACCATTGGTTCC
TGAGTGGTAAAGAGTCCTGGGGTGGGATATGGCAGCATGTGACTTGTGAATGGTGAGTGT
GCTAGACAGCTATAAATGCATGTGGCCCGGGATGGGTGCTTCAGGTTAGAACGTGATGCA
CTCTGTCCCCAAATCTGTCAGGTGGTGTCTGTCTGTATTAGGTATTTGCCATTTGTATGC
TTTCCATAGCTCTGCCATCCTGCTTCTCTAGGGGTTTTTCCTCAGCTCCCGGTCTATGGC
TTCACGGTCATCTCCATGCTGGGAATGTGTTCATTAGGACAGATTGTCAACACTTTGAGG
GAACACGGGCAGTGTTTGTTGTTCACGCTGCTTGAACTGTGTACCTTACAGTGGTTGCAC
TGGAAGCCTTTGGCTCCAGTGGAAGAATTCTGGGTTACTCAGTGTGAGGAAGAATTAAGC
CATTTCCCTGGTGACCTTTCCTGGTTTGCTTCTCTTTCAGATCTTACTGTGCTGAGATTG
CTCACAATGTGTCCTCTAAGAACCGAAAAGCCATTGTAGAAAGAGCAGCACAGCTGGCCA
TCAGAGTCACCAATCCCAACGCCAGGCTACGCAGCGAAGAAAATGAGTAGATGGCTTGTG
TGCATGTTTTATGTTTAAATAAAATCACAAAACCTGCCGTCGTATTTTCTATGTTTTTGG
TAACTGGAGATTGTTCTTTGCTGCTTGTTCTGGGGGAGACAGCAGGGTTCAGAATCCCAT
GCTAGTCTTGGTTGGCTGCAGGTGGAAGAGGGGAAAGGCCTTGACCCTCTACAGTGTAGG
TACACTTGAGTCTGGGGACCAGACAAACCTCTGCTCTCAACCCTGTCCCAACTCTAGCAT
GGGCTCTAGCTTAAGGCACTTTTTTTTTTTTTTTTTTTTTTTGTTTTTCGAGACAGGGTT
TCTCTGTATAGTCTTGCCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTC
AGAAATCTGCCTGTCTCTGCCTCCCAAGTGTTGGGATTAAAGGCGTGCGCCACCACTGCC
CGGCTTAAGGCACTTTTTTGATGAAGCCTTTAGTTTCATGGAACTGGCCTGCTTGGCCTC
AATCAGTCAGGATTGACAATCCTGTCTTTGGAGGATATTAGAACTTCATGAGACTGATAA
ATACTTCTGCCACGTGGGACACTACAAGGGCAGTGCCATCTGTATCTAGGCCAATCTCTG
GCTCGCTGTTCTTTTGAAACAGTAATGGAGTTCAGAAGGGTTGACTGTCACGGGTGACAC
TTAAATGACTGGAGAGAAAGACATCCCAGCCTTTTTATTACTAAGCTTTTGTTCTCATTG
TAGAAATGAGGTTTTATCATCTTGCTGTAGTGTTGGAGAGTGCTCTACAACTGAGCTATT
TTAAACTTTGGTGTTTTGCCTGTATATATGTCTGCCCGAAGGCATAGGGTCCTTTAGGAC
AGGTTAGAAAGTTGTTGCTACCAGGAGGGCGTGGTACTGAGCTATCCTGCCCTGTTGCTT
TTAGGTAGATCTTAAATTTGTTCACTACGACCTGAGTGTGTGGTCCAGCCTCAGCCTCCT
AAGGAATTAGGATAACAGGTCTATGCCATCGGCCTTGTTATTTCCAGGACTGAATCAATA
TGGATAAGAATCCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1050, 1846..1946, 2581..2762, 4060..4236
1851..1946, 2581..2762, 4060..4186
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved