Mus_musculus Locus Ptcd3
snOPY snoRNA Orthological Gene Database
Mus_musculus Ptcd3
Mus_musculus
Ptcd3
6
SNORD94
27070..27206
30115
GAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATTCGCCTGCCTCTGCCTCC
CAAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCCGGCAATGCTGGGAGTTTTTAATG
CATGTTGAGTTATTAATGGGAGTCTAAGAAGCGTGTATGCTATCGTGATCAAAAAGCATT
AGAGAAGAGTCCCCAGGACTTCATAGCCAGGGTCTTGATCCAAGATTTAAAAGTTCATCA
TCGCTTGGACCAGAGGAGACTAATTAGGAAGTTGATAAGCGTGTGATGTAATGTGATTAT
AAATGACATAAAACTAGTTGATTAATGAGGAAGATGAACAGATGAAAATGCAGCAAGCGC
ATTCCTTCCCATTACCAGCAAGCAAGCACTAGGCAGCCAGCCCCCCACCCCCCACCCCGA
CCCCGCCGCCCCCGGACTGGCTCGGCTCAAAGCCTTCTGGGAATCGTAGTTCCCAGCTCC
AACTTCCACAACCCTGTTCTACACGCATCCCACTAACTCCTTACTTGAGCTCTTCGGCCG
AATACATTCCGAAGGAAATGCCCTGAAGCCGCCTCCATGGTGTGTGCTTGGAGGCCAGCA
TCTTCCGAGTCAGTTTTGAGGTCCGTCACTACGAGAGAAGTTCCAGTCAGCCGCAGAGAA
CGCCACTTGAGTCTTGTAGCGCAGAGCCACCATGTGTTTTTCCACTGCGCTTGCGTGCGA
GAACCGCGGCTTGGCAAATTGGCTTGGACGAGTTCATTTTTGCTTTCGGGGTGGGTAAGG
AGTGGAAGAAAACTGTCTCAAAACCCTCCTTCAGTTTAAAAGCAAAATTACACAGGAGAC
TTTAGAACAGCATTTCAAGTAAGTTTATTCGAGGTGAACGATGTGTACTGAGCGTTCCGC
TGCTAGTCTAGCCAAACAGGACCTTGTGACCACCCGTTTGGAGATGAGACGTTCCACGCC
AGCCCCGCCCCTCGACCCTGGAGGCGGAGGTCGTTCCCGACGTGCTCCGCGAAGAGTCCA
AAGATGGCGGCGGCGGCGGTTGCAGCTCGCCGCCTGTCCTTTCGCAGCGGGCTTGTCTTG
CTGCAGACCACTCGGGGGACGGGTGTGTGTGAACCGAAGGTCTGTTGCAGGTAAGAAGAC
CCAGAGTCATTTTGGTCTTGCATTTCCCTGAGAGTCGTGAAAGTAGGTAAGATGCAAAGG
CATTTGTATGGTCGAGGCCCGGCCCTCTCAAGGGTAACACGAGGTAGCGTCGTATTTAGT
GATCTTTAGATCTGCGAGTTCGGGAATTCTTTCGGAAAATTTTTATTGGTTGGTTGCAAT
ACTATGTATAGCCAAAATTACCCTTTAAACTAGGGCCCTGTTCTCGTGAAGTTTACATTT
CCGTGAGTGCCGCTACAAGCCCCTACACAAATTTCTTTATCACCCCCCCCCCTTATTCAT
TTTAACCCTGCAAAAAAGAAAGGGCAAAGTAACAGATCTTTCACAAATAAAGGGCAGGCT
AATATTACCAGTATGGACTGAACGTTATGAGAACCTTCAGCTAAGAATAAGCTAAGACTT
TAGTAAAAGCAGAAAGCCTTAAAACGTCTGACCCCATTCTTTCCATCTGGTGGTGTTGCA
AATACTTATGTAATTTCTTTGTACATCCTTCATGCAGTGGCCTGGTGGAAATAGGAGGTG
GTTTTAAGTCAGTTGTAGAGTGGATAATTAGCTCATACGATGTCTTTGGACCAATACAAA
AAAATAAATAAAACTGGGTTACAAGTTTACACTACATCTAAATGCCTCTATAAATGTGGC
TCAGAATGTGTGCATGCGGGTGGAGCTGAGTCAGCAGAGCTAGCGGTAGGAGCTGAGCTG
AGGCCATCAGGGAGCAGTGCTAACAGTGGGATTTTTGTTGTTTTGTTTTTAATGCAGATT
TTATGCTGGAACTGAATCCCTCCCAAAGGTTGAAGGATCAGATATAACAGGTATTTTTAA
AACTATGGAAATAGAAGTTTTTAAAAATGAAAAGACATTGTATTTCTTTGTGTTGTTAGA
AAATTGTTTATTTTTATTTTTTTTTCTACATAAGGGATTGAAGAAATAGTCATTCCAAAA
AAGAAAACATGGTGAGTATTTTGCTATTCACTTACCAGGTGATTGGGTATTTACTGTAAA
TAAAACATAAGGATTTAAATAGTGCCTAGCACATAGACAAATACCATGTTAGCTGTTATT
TTTTAAGTCTTGTTATATAATTTTATGTGTAAACTATACATTTAATTTATAAGTGAACTA
TTAGGTGTACTTTTGTTTCATTTGGAGTGGCTATTTGATATCATTGTATAAATATGATTA
GATTCATTTGTTTCCCTGCATAAGAATAGGAACAGTGGCTGACCATGGTACCATACTCCT
TTAGTCTCAGGAGGCAGAGGCACAGGGATCTCTGCATAGTAGGACTAGTGTACCTACTGA
GTTCATACAGTAATGCCCTGTCTTTAGAAACAAGAATAGGGATGAGAGAGCACTGGAGCT
AAGAGTAGGGACTGGGTTACCTGTGAATACAGCATTCCAGCGTACGCCCCTTTGCACACC
TCTATATCCAGAAAAACGACAAGAAATGCAACAGGAAGAGTATTTACAATGTGCTACAAT
CTAGTTGTCACCTGCCTGTGTTGTATCTTATAGTCCTATATGTATGCAATTTTACCCGTA
TAGATAGACAGAATTTAGGTATATATTGAGTGTTGTTTTGTAGTGACATACTCCTGTAGT
CCTAGCACTCAGGGCAGAAGTTGGAGGATTGTCACGAGTCCCAGGCCAGCCAGCCACTTA
TTTAAAATTTCCCTTTTTCCTATTGGTAGTTCTTGTGAGATGTATTAGGTAAAGAGTGCA
GGAAGGCAGGATGTAATATGATTGTTGATTATGGTGATAGTTCAGACAGGCCTGTGGAAA
ATGTTAGGAAATAAGAAACGGTTAGCAAGTCAAGGCCTTTAAAAATTCAGTTTATAAGCT
ACGAGTGCTTTTATTTTTCTGTGTAGCTGGGGGAGAGAGGCTAAAGGAAAAAAAGTAACT
TGAAAACTATATTTTAAAAATGTCAAATTTTGTGTGGACTGCAGCTTACTTTGTTTACAT
ATATCTTACGTTTTATTGTGTACAGTCCTGCCTTTCCCACCCCCACCCCACCTCCCAAAA
AAGAAATGGTGTAGGGTGGATAAAAAGAAATGGTGTAGGGTCCTCTGGTTTGTAGGCTTG
GTAGAGTTTCAGACTACAAATTTGTCCTTTAAAGCTGTGATCTTCCACATCTCACAATGC
CATAGAAAACGTGAATAGATTTTAGTTTTTTGTGGATTTCCTTACATGAGGATGACATGA
TAAAGACAGTGAAGGGGGTTAGTGTAGATTATGAGGTCATTTTAAAGAGGGCAAGCAGCC
TACCTAGGATTTATACAAGAAACACAATTTAAAATCTTCCATATTAGCAAAGAGTGAAAG
TGTGTGCTCAGAAGTATTTGTTGATGGAAGAACAAATTTGAACAATAATTTGGGCAGAAA
TAGGGTCAGAATTTAAGAAAGTATCTGCATCTTACTGGCTAGCCACGCAGAAGGAATACT
TGCATATGTACCCAAAGAGCTCTAGAGCAGGTTGAAACAGTCTAGATAACGTGCTATCTA
TAACATTTAAAGGCATTAGTTACATCTGCATAGTCACGTGGATCATAGAAACCCATGTAA
ACACGTTCCAAGTGACACCAAGTTGGTTTTGATTGTTTTTGTTGTTTTGTTTTATTTTGT
TTTAATCTACTTAAGTTCCTGGAAATGGAGGGTTGAAAATGAACTTGCCTTGAACAATCG
AAGCCTTGGGTTCAGTTCTTGATAGTGCTTGAAACTGGGTGTCGTGGCACGTGCCTGTCC
TATCACTAAGGATGGGGAGGCAAGAGGACCAGAAGTCTAAGGCCATGCTCAGCAGCACAG
GGAGTTTCAGGCCAGCCTAGACTGCATGACACCCTGTCCCTAAAGAAATTTTTTTTCTGG
GGATAAGAAAATCATGTTGGGTAGGATCACAATATGACATCAGGCACCATAGTAAGGATA
CAAGCGAGGCGCTGTAGTGGCTTTGCTTTAGTTGTTCCAGGGTAGAGGTAAGAGCCGTTA
GTTTGGATAGTTAGCAGGAGGCCAGAGGTGCTCTAAGTGGGTTGAAGGAAGTTAGCAAGG
TAGATTTATGGGGAGAGAGAGGAAGTCAATTTTCCTGGGTAGTGAATGGTAATAGAGACC
AGTTAAGTACATAGGAAGCAAAGGGAAGGAGGAATGTGTATCTGTCAGGAGAACCAGGCT
TGTGGTGCTGAGCGTCTACCCCACAAGAACTCTAAGCTCCATTCTCTAGCACTTGATTAT
TGAGTTAGAGTCTAGCTCTGAAGTCCAGCTGGTCTCAAAACTTCAGTCCAGCCTCTTCCT
CCCTCTTCTGAGATTATAGGATTTGCAGGCATGCCTGCTTCTCACCTATTCCTGTTGTAG
TGGATTTGAGAAATAAGTCCTGGCCCTAGGTGAGAGCTGAAGTGTCCATCTTCTTTTATG
CCCAGTGTCTTCTGAGAGTAGAATGACTTGATAAAGGTTGACTTGTGGTTCTTATTCTAG
GGATAAAGTGGCTGTTCTTCAGGCACTTGCATCCACAGTAAACAGGGTAAGTAGGATTTT
AAGGGTTAATAACACATTCAGTGTTATAGCTCTTTATTCACCATAATTAAACTGTTGTGT
AGCTCGAAATTTTCTTGAAAACTAATCCAATCTCTCCTTTGGAAAATGGGAAAGCAGGTT
TTGAAGTGACCAGCATAGGACTGGTTAGGATGTGATGCCCACGTAGTTTTTTGCAGCATA
CTGGTAGTTGTGTGTTTGTGCTGTTTTGCTTTTAGAAACGGGTTCTCTCTGTAACATAGT
TCTGGCTGTCCTGGTATTTGGTATGTAGACCAGGCTGGCCTTGTGCTCACAGAGATCCTC
TTGCTTCTGCCTCCCAAGTGTTAGAATTTTTTAAAGGTGTGCATCACCAGGTCCACCTCA
CACTAATAATTTTTAATTACTGGAAAAGCTTCTTGAAATGAAGTAATTAAATAAATTAGA
AATTAGTTTTAAAAAAAAACAGGTGCTTGTTTCTGAGGATAACCGTGCACAGCCATTGTC
TTTATATGACTCTGAGACATGGGTCTTTCCTGCTGGTGGTAATACACTGGTCAAATATAG
ATCTTTTGATGGGTGTGGTAGAACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGTCTG
GAGGATCTCTGAGTTTGAAGCCACTCTGATCTGCATTATGAGTTCTAGGATAGACCAAAA
CAAACAAACAACAAAAAGCAAAATACAGATTTTTCTGGGCATGGTTGTGCAAACTCGTAA
TCTTTGGAATCATCGTGGACTAAGGTGGAGTCCACATAGAACGCCCTAACAGGAGGTGAG
GTGACTATATAGGTTAGGGAGCTGGAGTTTGAGTTTCCAAGAGACACACATAGTTCTGAA
TAGCATTTCAGATGCCTATTTACAGACAAATGAACTAACTGTTCAACAACTGTCCACCTG
ATTCATTGGAGCCAAGGTCTCAGCCAAACGAAGAGCTCAACTAAAAAGGCTAGTTTAACT
AGCCAGTATTCTGGGAATCTCTTATTTCTGCACTCTGAGCACTAGAATTAGTGGGCTAAC
TAGAGGGCTGGCATACCCATCCCATACTTATATGAGTTCTGCCTCGTGCTTGCATGGCAA
GTGCTGGATCTGGTTAGCCATTCTCAAGCCCCTGGAGAAGGAACCTTCAAGTAAAGTTGC
ACATGGGCACATAATGACTATGCAGTGAAGGAAATCTTATTGCAGGAAGCTGTTGGTGGG
AGTAGGTAATTCATGGGTCCTTTACTAGAGTTTAAGACAGTGATAGTCCTGACAGCACAC
TGATATCCTAAGAAATAGACTGAGGAATTAGCACAATGCTAAAATGATTACTAATTAATT
TCTGAGACCCTGGGTTCTATCCTAGCAACAAGAGAAGGAAAAACCTTTTAAGATGGAGCC
GTGAGAGTTTGTACTTACCAGCTTTGTGTTGTGCCAACTTGGGGGAAAGTCTTACTGACA
TGTGTTTTCATTTTATATATGCAGGCACATGATTATATCTACGTGTACATTTCCTGTCTT
AATTAAAATTTTATTTTATAGAACTTGTGATCATTAAAGCTTAGACATTTTAGCAAAAAT
CTAAAGAGATGAATGTGCCCTTTCCACAGGATCCTACAGCTGCACCTTATGTATTTCACG
ATGATCCTTACCTCATACCAACCTCTGCTCTGGAGTCTGTGAGTACTATTGGGTAACTTG
TCTAGGAATTTTTAAAAGCCTTACTGGTTTGTGTAAGGATATATAAGTAGCTAAACTATT
AAAATAAAATAAGAAACATTGAAAAGTTTACAAATACTGACAAATTGGTAGACTCTGAAC
CTTAATTTTATCAAAAAATATTTAAGTTGTTTCTGAAAAAGGTTTTGGGTTTAGTTTTTT
TTGTTGTTTGTTTTTTTAGTATTAAGGTCTTAACTAACACTTAAGCAAACCATGTGTGTC
TGTGGTGTATATAAAACATGACCTGAAATCAGTACCATACTCAGAAGTGAGATGTGTGAA
GTACTGTAACTTGGCTTGTTTTGGGGACTTCTTGTATTATTGTATTCTTTTTCCTGGGGA
AAAGGGAGCAATTTTTGCTGAGGGTGTAGTCTTGTTTGAGTCTAAATTATTTGTAAGTGC
TAATTTGTATTTTTCTTATGTAGCGTTCATTTTTATTGGCAAAGAAGTCTGGAGAGACTG
CAGCAAAGTTTATTATTAATTCATATCCCAAATATTTCCAAAAGGATATAGCTGAGCCTC
ATATACCGGTAAGGAGAGGAGATTGTGTCTTTTACATTGTAGTATGAATACAAATTAAAT
CATACTTCCACAGCAGATTTAGCCATTTTAGTGCCCAGGATATTAGAATGAGAACCTTTG
CTAACCTTTTAAAATTCTTTTTTGTTTGTGAATCTTCTACTCTTTGACAGTTCCTTTTCA
GGGACCTCTAATGGCTTCTGGCATTTCCTTATAAATATTGTCTTTATGAGGGTTCTTTGC
CCCGTTTTTCTCTTGTACAGTCTGCACTTGGTGTTTTGGTCATTTTTGCACTCCATTTGC
ATTGTTGTCTGTCTTACCCACATTCCTCTTCTGACACCCCTTGGAACAGGAATTGTACAG
TATCTGCAGAGTGTCCACCCAGCAGCCACTGCAGTCAGTTAAACTGTAGCAGTGGGAAAT
GCCATCCTAGGCAGCTGCTCCTGCCTGCAGCCTCTCCCTTCTCCTTCCTTTCCCAAACTC
ACCCCCAGACAAGCCGTCCTCCTCATACTGCAGCTTATGTGACTGACTGGCAAGCCAGTA
CAGTTGTATAGTAAGAATATGAGAACAGTGGCAGTTGTAGAATGCTCAGTAGTTGGCCCA
TCACTCCCCCTTTTGGCTGGCAATGCTTCTGTGCTTGCTGGAAGCTGCATGGGTCTCCTG
CCTTGGAGGTGGTGTCATTGCACACTGTGCTGTAATTAGCCCTGTCTCTGTCTCGAGGGT
TCTGTGTTGGTGATGGACTATAGACCCTCTTGTAAGCTCTCTGCCATTAGCTGTGCCCTG
AGTGGATTGCTTTTCCTGCTGTGACAAAATACCTGACAAGCAATGAAGGAAAGTTGTAAG
TCAGCTTAGAGTTTAAGGAAATGCAGCCCATCATAGTAGGGAAAGAATTTTAGCAAGAGC
AGTAGGCAGCTAGTCACAGTATAATTGAAAAGGAGCCGAAGCCATGCATCCTAGTGGTTA
GCTCACTTTCTCTTTATCTACAGTCCAGAACCTGTGTGAAACGATCCCAGTCACATTTCA
CCTCCGTTAACCTGACCTAGAAAATTCCTCACAGGCATATCCGGAGGCTGGTCCTTTTGG
CTATTTTTGAATCTGTCATGTTGACAGCATTAACTGTCATTAGAATGGGAGTGCTTTGAA
GGTAGAGCAGTCCCTTTAAAAGCATCTTAGAATCCCTAGTGCCTCGCTTAGTACTTGCAG
TAAAGGAGTTCTCATTTGAAATACATTAGAAACATTAGCAAATGGAGTAAAAGCAAAGTA
TTTAGATCAACCTCAGGTTGAGGCCCTTAGTTGAAAATATGGAGTGAAAATTTATGTTTG
AATATTTTTAAATTTTCATCAAGTCAAGGAGATGCCTAAACAGCCTTCTGTCCAGGCTGC
AGACGTGTACTGGCCTTTCTCGCTTACTTGTATATTCTGTTGTGGGCTTTGTACTAAGAT
GTAGGTGTTACGTGGTGTAGGAAACAGGAACCAGAACAGCCTCGCCTAGTGTCACCCTGC
CACCTTGGCCTGTTCGTAGTCATTCACTTCTCCTCTTGTTCTAGTGCTTAATGCCTGAGT
ACTTTGAGCCTCAGATTGAAGATGTAAGCGAAGCTGCCCTGGAGGAGCGAATCAGACTCA
GAAAAGTCAGAGCTTCTGTGGACATGTTTGACCAGCTCTTGCAAGCAGGTGACTCTTTTC
AGTCAGAGCCCTCCTTCAGCATGGGGACCTTGTATACAGTCCAGTTAGCTTGGAGTAAAA
ATAGCAAACAATGCTTACTCTGCTTGCTGGCGCTGTTTGTGATTTAATTGATATAGTATG
CATAATTCATTTTCTGCTCCTAGCTTCACCGTGAAATTATAAGTGAAGTAGAGCTGCAGG
TTTATTCCCTTCTGTCCTGTGCACTGGCAAAGGAAGTACATGGCCTCTGTTTCTAGCCTT
AGGTGTGAGAAGGCAGAGCCAAATAAAAGAGAAAACTTGATCTTTATTTTATGTGTGAGT
GCTTTGCTTGCATGTATATCTGCATCATTTGTGGGCCTACTGCCTGGGGAGGCCAGAAGT
GGGCCTCTGATCTTCCTTAACTGTACTTATAAGATTCATTTATTATTATGTCTAAGTACA
CTGTAGCTGTCTTCAGATGCACCAGAAGAGGGCGTCAGATCTTATTATGGATGGTTGTGA
GCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTTGGAAGAGCAGTCGGTGTTCTT
AACCACTGAGCCATCTCTCCAGCCCCATAGATGGATATTTGATCACTGTTGTGGGTGCTG
AGAATCAGACCAGGTCCTATGGAAGAGCAGCCAGTGCTCTTAACTCCTGAGCATTTTTTG
AGCCGCAGAGAAATGCTTTAAAAGAAAGACTTGTTCAGTGGGGATCAGGGACTTTGATTG
ATAGGGTTCTTCCTCACTTGGTAGTCTAGCAAAGATCTTGTCTTTTCTGAGCATCTAACT
AATGTCCTGTTGTGTTTTCAATTAGATCTGGGTGAGTTTATTAATAAATATAATTCTAGG
TAACATGACTGATATGCTACTGTAAATACGCACGTGGTCTCTTCAAACTCAGCTGTTATC
ATTAAATTTTAGGAGTCTACTTTGCTGTTAAGTGAATTAGAATAAAAATTTTGCTAAACA
TAAGAGAAACAAACTGGACAAATCATTGAACATATTATTTGAACCCAAAAATACTTTCTT
ACACTCATTTTCAAGAGTTTGCTTATGTAGCTTCTAATCTATCACACGCACAACTGAAGG
GTGACACCAGCCAGTATGTTGGTGAGGTTCTACCTCTGCTTCCTGAATGTGAGCCACAGT
TAGTAAGGATCTGCAGTGAACTCCTCAGTGCTGAGGTGTTTAAGTAACACCTGCTGTAAA
AACCTATTGAGTGACTGCACACACCTATACCACTGTGGGCACCGCTGGAAGCCTCAGCAC
TCAGGCGTTAAACACTGGTTCATCAAGGGTGACCTTGAACTCCTGCCTCAGTGTCTTGAG
TGCTAGGATTACAGGCATGGGCACTTATGTTAAGCTTAATAAATTGAGTCTTTTAGGGTT
TTTAAAAAAATATTTACTTTTGGAAAACATTCTTTTAAATAAAATTTTTATTATATTTTT
GCATGTATGAATGTTTTGCCTGCATGTGCTTGCCCCACACTCTAGGAGGGCAGAAGAGGG
TGTTGGGTCCCTGGGACTCAAGTGAGGGTTGTAAGCCACCATGTGGCTGTTCTGGAAGTT
GAACTCGGATCCTCTGTCAAAGAGCAACAAATGTTCCTAGCCACTGAGCCATCTCTCCAG
GCCCCTCTACTTTTCTTTCCTTTTTTACTTCTCTCTATAAAGTGAGTGCTGAAGTGGGAA
TTATCTCATTTTGAACAGTGGGGGTTTTTGTGGATTTTATTGTTACTTATTTTTGAGGTG
CTGGGAGTCAAACAGGTTGGGGTTTTGTTGTTTTTGTTTGTTTGTTTGTTTGTTTTTAAT
GAGACAGGGTTTCTCTGCGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTG
GCGTGCGCCACCACTGCCTGTCAAACAGGTTGTTTTTAAGGTTATTACAATTACACAGCT
ATTTTAGTAGTTCTGAGCACATTTTTAATGAGGGCCTGAATCCAGTTGGGATAATTGTTT
GTGTTTATTATAGTGGATCAGGTGTAAGAGAATTGAGAATGGATGTGGACCAGCAGGTTG
TCCTTCAGTGATAGGTTCCAGAGAGGAGTGACCAAGGTATCAGAAAATAAGATAGGAAAG
CTGGTGTCAAGAGGTCTTGTACAACCTGAGTCTTATGCCAAACGAATTTATTCAGAAATA
TAGTTTACAGGGTGTCTTAGGGTTTCTATTCCTGCACAAAACATCATGCCCAAGAAGCAA
GTTGGCGAGTAAAGGGTTTACACTTCCACGTGGTGTTCATCACCAAAGGAAGTCAGGACT
GGAAACTCAAGCAGGTCAGGAAGCAGGAGCTGATGCAGAGGCCATGGAGGGATGTTCCTT
ACTGGCTTGCTTCCCCTGACTTGCTCAGCTCCCTTTCTTATAGAACCCAAGACTGCCAAC
TCAGGGATGGCACCACCCACAAGGGGCTTGGCCCTCCCTCCTTGATCACTAATTGAGAAA
ATGCCTTACTGATAGATCTCATGGAGGCACTTCCCCAACTGAAGCTCCTTTCTCTGTGAT
AACTCCAGCTTGTGTCAACTTGATACACAAAACCAGCCATGGGGGGTGGGGTGGGGGAGG
GTGACAGAATCAGCAGAAAACAATCATTCATTATGTACTAATTGGTAACATGGTAGTGGA
AATAAGCCACCATCAATAGAAAAGCTTCATTCAGGAGGCTTTGGGTGTTTGAACATTTGT
TTGCTTGTTTGTTTTCTCCCAACCACAGGAACCACAGTCTCTCTTGAAACAACTAATAGT
CTTTTGGATTTATTGTGTTACTATGGTGACCAAGAGCCCCCAGCTGACTATCCTTTTCAA
CAAACTGAACATTTGGAAAACTTGGTAAACAAAATTAAAAACTTGGCTTTTTTGTTTCTA
AAATAATATTTTCTCAGTGGGTTAGGGTTCTGTGTCGTGTCATAGTACTAAAAGATTTTA
TACTGAGGTGGCCTTCTGTAAACATGATAGGGACACATGAACTTGTTTTCCAGTCACTTC
TAATCAATGTGCACTATACAAAATAGTATGTTTTGTTACGACAGTTTCATACTTGTATGT
AATGCATTTTTATCATACTCCCTCCACCTTTACCCCCTCCTTGCCCCAGTGGTCTTTTTC
ATATTCCCAATTTATCCCTTTGTACGTTGTCTTTATGACGTATATGTTTTAGGAGATTGT
ACAGATGAGAAAAAGCAAGCAACGTCTGATATTTTTAATCTATAATCTCTAGTTCCACTG
GTTTTCTTAGAAATGACATAATTGTCAACTTTATAGCTCAGTAGAACTTCAGTGTGCTTA
TGTTCCACACATTTAGGGGGGAGATGAGCCTAGGCCCTCCATATAGTAGGCAAGGACCGA
ATTGTGAAACTGTGTCTTCTTCCCCCACTTTTGTGGTTGGTTTTTTGTTTTGGAATTTTT
TTGTTGTTGTTGCTTGTTTTGTTTTATGAAACAAGGTTTCTCTGTGCCCTGGCTGTCCTG
GCATTTACTCTGTAGACCAGGCTGACTTAAGACTCATGAGATTTGCCTGCCTCTGCCATC
CAAGTGCTGGGATTAAAGGTGTACATCACCATGCCCAACCCTGTTCTTTTGTTTGGCTGG
TTGGTTTGGTTTTTGAAACAAAGATGTTGCTTGGACTAGCCTTAAATTAAATTCCACATG
CCTTGGCCTCCCAAGTAGCTGCCTTGTAGGCTCCTTATTAGGCCTAGCTACTCATAGCTG
AGTGTGCTAGCACACCTTTAATCCCAGCAGAGAGGCAGAAAGCAGTTCTCTGAATTTGAG
GCCAGCTTGATCAGATTTTAAATGAGTGATTATCTGGAGATAAAACAAAGGTAACAAATT
TGACTTTCTCAGTGTGCACTAATTTTCACACTAAAGGAATTCACTGTAGGTGTGAACATT
TGGGGGGCTTTCCTTTGCCTTTTGATGATCTGATATTTAAGTTTTTTAAATTTCCTTTTT
TGTTTAAGTAGCTTGCAAGCAAGCATTGTCTTACCTTTTATTTCATCTGTTCTAGGAAGA
AGCTGCAGAGGAAAATAATCAAACATCCAAGATGGAGTCTGGTCCTTGGAAGTATGTTAA
ACATGAAAATCTTGTGTTATAGGAATTTTACAGTACATGAAAAATATGCTACATTGTCCT
CTAGAGTTGCGATCCCATAAAATGTTCTAAAATAGAAACTTTTTTGTTCATTTTACAGAT
TTATTCCATAATCTGTCTTTGTATATTATATTTTATACCTTTTGCCTTTTTTGTTTTGTT
TCATGAGACAGAGACTCTGTAGTTTTGGTTTTCCTGGAGCTCACTATGTAGAAGAGGCTT
GCAACAAACTCACAGAGATCCTTGTGTCTCCTGAGTGCTGGGATTAATAGTGTGTGCCAC
TATACCTGGTTTCTCAGTTGCTTCTTTAAGATTCCACTTATATAGCCCAGGCCAACCTCA
AACATGGACCATTCCTGCCAGGGACTGGTATAAGAAGTGTGCTGCATCACTTGTGGCTTA
GACTATTATGTTTTATAAGATTGTTACCTCCTGCCAGCATACAGAAATCCATTTAGGGTT
TGGCCTGGTTGTACTTTGTGTTGTTTTTCATCTGTGTATAGTTTAATTAGTAATGCTACC
TTGAGATGTAGATCCCTAATTCTTAAAGATTTGATTTGATTGGATATATAGAAAAGAAAG
GCTACCATTAATTCTAGAAATTCTAGTTTAGAGAGATGGCTCAGTAGTTAAGAGAATTTC
CTATTCTCACAGAGGTTCCAAGTTCTGTTCCCAGCATCTTGTATGTAATTCCAGCTCAGG
GAGATGTGACCTCCATGGGCACTAGCACACACTCAAACAGATGCACACACATGGACTTTG
TAGTAAGATCTTAGCTAGTATCATGGGGTCTTCAGCATACAGATACATTTATACAAGGTA
GGTACCATTTTCTTACCCTCTAGTAGAGAGGCAAAACTGCTCATGCTAGAATATGTCAAG
ACTCAGGATCAAGGTTACCTTGTGGAATTTTATTTTGGATGGGGCAGATTTCTTGTCATT
CCTGATCATGGCCCTGACATCTATGACAGCTTAGGATCTTTAACCAATTTTGAGGTGATA
TGTACATTGCCCAAAACATTTCCAGAAAGTGGTGGCACTCAGCACTAGTTTTCTCTGTGC
CTCCAGTTGATCTTTCCTCTGCTGTTTCTAGAGCACAAAACAATGCTGAGAGGATCTTCG
CTTTAATGCCAGAGAAGAATGCACGCTCCTACTGCACGATGATCCGAGGGATGGTGAAGG
TACCTTTCTTTGTTTATTTGTATCTTGAAGTTTATTTGTATCATTGAGTTTGTTCTGTTC
CACCCCTATGCTAAAAGGGCTAGAAAATGCCTGGGATCACGAATATATGCAGAATGTGAT
ATTTTGGGGGTCAGTTTTAAGCAAGATACCTATTTGCTTCATACATTTTTCAATAAGCAT
AACATGAAAAAATTATATTTTTTGAGACAGGGTCTCTGTGTAACCTTAACTGGATGGATG
AGCATACAAGGCTTAAACTCCTGAAAATGTCCCAGCCTCATTACAGGTATTCCACAATAC
CTGGAAAAAAAAATTCTTTTTCCCTTTTCAGACACATCTCTGAAATTGTCTGTCCTGCCC
TCAGACTCAACAAGACTTCCCAGAATAATTGGGATCCTGGGCATACACTACAATACTTAG
TGGTCATTTTACGTAATATCTTTGTCAGCCTGTGTTGTCTACAACCTGTTAAATGAGATC
CTGATTTTGTCTTTGTGTCAGTCCTCAAAAATTTTTGAATTTAGTAGCATTTCAGACTTT
TGAATAGGGATGAACAGTAAACTTCATTAAGTTTTGTGAGTTTTTAAATTTCATGCATGT
ATTCATGCATCTGTCTGTGTTTAGGTTTATTATGTGAGTGAGCGGGTGTTGGGTTTTTTG
GAGTTCCTATGGGAATGAGAACGCCAGTGCTTTTGGTTGAGCACCAGGCTGTCTTAGGGA
CTGAGCCGAGCTCCCACACTGAGACTGACATGTTAGAGCAGAGCTTGTAGGGAGCTTTCC
GGTGTGTGTGGAAGGTGTCCAGGTGTACTGTCTTCCCCAGTTCTACCCATTAGATGTGAG
TGACTTGTTTCTGCCTCATTCTCAGTTGTGACAACTGAAACTGTCTCTAGGCATTGCCAG
TGCCTCCTGGAAGAAACCCGCTTCACTGGGATGCCAGCTTCCCAAGAGTAGGCGTCTTCT
GTGTTGTGTGCTCACCTTCCCAGTTGGGGAGACTTTGATGATGTTCGCTTTTTCCTCTCC
AGCACCGAGCTTATGCACAGGCACTGAACGTGTACACAGAGTTATTAAATAACAGACTTA
GTGGTGAGTTTAAGGCCCTCACACCTCTGTCTTCCTCTAACGCAGTGGTTCTCCACCTTC
CTGATGGCTGCAACCCTTTAATAACATTCCTCATGTTGTGCTGACCTCCAATCCATAAAA
GTATTTTCATTGCTACTTCATATCTGCAATTTTGCTACTGTTTTGGATTGTAATGTAATA
CCTGATATGTGAACCCAGAGGTCATGGCCCACACAGATGGGGAACTGCTGCTCTTACTAA
GATTCAGTGAGGTCTTTGGATTTTGCTCTAGTTGTTTTGGGGCTTGGGAGGGTGTTTTTG
TTTGTCTTGTGCTCATAATTAAAACGGGAGTGGAGAACTAGTTCTAAGGCCTTACTGAGG
TTAGCTAAGACACCAAGACTGACCATTATCTCATTTTCAGCTTTTATGAGGTGAATTTTC
AGCCTCACGTTTTGTTACTTTTCCCTTACAGCTGATGTATATACCTTTAATGCATTGATT
GAAGCAAAAACATTCATACTCAATGAGAAATTTGAGGAAAAATGGAATGATATACTGGTA
AGCAAGCAGCTTCTTTACCTTCAGCTACCTTACTAGTAAAGGTTAACTTAGCATTTCTGT
GGAGCAGCTCCTCAGAGCCTATCTACCAGGAGGGAAGAAAGCACTGATCATCAGTCACCA
TATACAGCAAGAATTCAGGAAGAGCTGCAACAGTTCACTGTAATTGTTCTTGTTGTAGGT
TACAAAGGTATCATATGCATTAAAATTCTGGCCAGAGATGACAAAGGGAAAACACGAGAA
AGGATTTTGGGCAGAAGTTAAAAGTAGAACGTTTTAGTCCCATAGTTCTTAGGTTATTTT
ATTTTGTTTGTTTTATCTCAGTTAGGTGGAAGATTGCAGATAGACACCATGACTTCTTGC
ATGGATGATAGGATGGAGAGAAAGAGGCTCCTTGGCCCCCTGACAGTGTTAGGCTTTCCT
AGAGGGTGGGAATGCTGCCCGTGCAAGGCAGTGCTTAGTCACGGTTTGGGGGTTTTCTGA
TTTTCTTTAAGAAAAGACCTCACTGTGCAGCCCTTACTTGCCTGGAACTTGCTATATGAG
CCACACTTGCTTTGAACTCACAGAGATCTTTTGTTTCTGACTCTTAGGTGCTGGATTAAA
GGTGTGGACTGGGCTGTTTACTTATTAAAGCATATAGTTTTTAATTGGGAGTATGGTTGT
TAATTTGTTTTACATGTAGCCACAGAATAAACTTTTCTCAACAGTTTTGGCAAATTACCT
TAGATTAAAAAATGTTTCCTGTTTTGGATTCACCCAGGATCTACTGAAACATATGGTTGC
ACAGAAAGTGAAACCAAATCTGCAGACTTTTAATACAATATTGAAAGGTCTCCGGAAGTG
TTACTCACTTGGAAGGATACCAGCCTTACAGATACTACGTGAAATGAAACATATTGGAAT
AGGTAAGGAATCCACACTGAAGATGAAGTGAATAGGTGGCCGCTGGGCTCAGCCACAAAA
GCAGGAAGTGTCTTCATCCTTAACGTCAAATCATTCTGTTAGGGTTTTCTTACTGCATCT
GTAACTTCAGGTGCTGTTGGCCCTTTGTATCTGTTGGATCTATCTTAGAATTCAACCCCA
GATAAGAATGGCAGGAAAAAATAATTGTAAACAGTTTTTGGTCATTCAATCCTAAATAAT
ACAAGAAGTATTTGCCTAGATTTTATGGCATATCAGATATTACTGGTGGTCTAGAAATGT
TTTGAAGTACACATTAGGGTATGTGTGGGTTATATGCAAATATGTCACCATATCAGCATA
TAGTAGCCAGGCATCAGTGGGATTCTTGGTCTATATCCCCATGGATACCAAGTGGACACT
GTCTGCAGCAATGGGCTTGCCTTATACTTGGTGTTCTCTACAGGAAATACAAGGTTACTT
TAACATTTGAGAGACATTTTTTCTGTAGCTCTCTTGATTTTGATGGAAACTGATTGCTTT
GTTAGCCAGCTTTAAATTCCATGACATTTTTCTAGCATGATTAGATGCTCTAACCCAAAT
TATGTGCTAACATGCTGTAGATACTTCAGTAATTACTTGGAGATTAGGTGGGCATTAATT
GACTTCATGGTGCTTTGCTCTTCTCACTGATTGTATGAATATGACAAAGTATTGCTGTCT
TTACGGTGATCTCATCTGCTTATGAGATGAGCTAAAACTATCTTCAGAGGAATAGAAATA
GTAACATTGTGTTTCAGCTTTATTTTGGTTAGCTGTGTTTTTACTGGTTTTTTTTTCCCC
CCTTCATCTACCTGGTAATTTGAGAACCCTCACTTGCAACATACCATCATATTATTCACC
TCTTTTATCCAAGAGGTATGTATAACCTTACATTATCTTGATTTGTATATAAATTGACCA
TCTCTGTTGAGTTGTTAGAATTGTTAAAGTATCTGCTCTATATATGAATTAAGAACAGAG
AATTCACTGGGCGTAGTGGTGAGTACCTTTATTTAATCAGAACACTCAGGATGGGGAGGC
AGGTGGATCTCTGAGTTCAAGGGCAGCCTGGTCTACCTACAGAGGGAGTTCCAGGACAGC
CAGGGCTACATAAACCATGTTTTCTGGAAGAAAAAAGAAATAAAAGAGTTCAGAGGTGGG
AAAAAACAGTGACTGCTCTTCCATAAGACCCAGGTTCAATTCCCAGCACCCATGTGATGG
CTTAAAATCATCTATAACTCCAGTTGCAGTGGATCCTAAGCTGCTTCTGGCCTCCAGGAC
ATGCATAAGCAGACAAATACCCATGCACGTGAAATAAAAATAAATAATAATTTAAAAATA
GAATTCAACCCTACATGGTTGCCTTCCTATAATCCTGCACCAGCACTTAGGAGGGAGAAG
CAGAATCAAGGTTGGAGACATGGTGTGACTAGTGGTACCCTTGATTGCAATATAAAATAC
AAACTTGGAGAGGGCTATCAAGTGTACTATATCATTCTTGCACTACAAAAAAGAATAGGC
AAGGTGGGTTGTAATTAAGGGTTTCTTTTGGTCTTTAGAACTGTGCTACTCAGTATAATC
GCTTAGTAGCCATAAGTAATTACGTAGTTTATATTATTTTTAAAATCTTGACATTAAGTC
TTACCATTCATTCTCTTTCCTTTGTGGGTTCTAAGAATCAAACTCCATCATCAGGCTTGG
CAGCAGTTGCCCTTGTGTGACACCGAGCCATCTAGTGCCCCACAATGTGCCCTTTCTTAA
TCTGCCATCTACACTCTTTGCCAGTTATCTTCCTCAGTGATTCCTCTTCTCCTCTCACAT
CTCATATATGAACATATGCACCTCTGTAATCTAGATGTTATTTGAAAGAGAAATGTAATA
TTTGTGTGAATGTAACATAACTGTACTTAATATGATTATTTCCAATTCTGTTTTCCTACA
AATGGGACTTAACTGTTGCCCTTAAAAAGACCTCTATCATGTATTTCAGACCTGCTGGCA
CCTGTCTATAATCACAGAATTTGATAAGTCAGAGCAAGCATGTTAGATGTTTTCCAGGCC
AGCAAATGCTATATGAGTCTCAGAAAAGGGGATAGAGGGGATCTAGGAAGATAGGACAGC
CTTTAAAATGCTTGTTACACAATCAAAAAACTATAGACTTTGATCTCCAGAACACAGGTA
CACACTTACAGTCCTAGCAGAAACAGGTAGGTCCTTCACCTTGGGGCAATCCAACTTAGC
CCTTTTTTCCTTGACTTGCTCTTGTCATTGCATTTATTTTATCAAAGCACCAAGACAGAT
CCTGTTTCAAAAAGGCTTGATAGTTCAATGGGCTAAGTGTTTGCTTTGTAAACCTTGAGA
ACTTAAATTGAATTCCAGAACCAATGTAAAGCCAGACTAGGTAGTGGGCATCTAATCCCG
TGTTCCACGGTGAGATGGGAGGACGGGACTAGGGAATCCCAGAAGCAGCTTGGGTAACCT
CTGGTCCATGATAAGTCCTTGCCTGTGGCACTGTCTTGAAGTGTTGTCCCTTTGATGGTT
TCTCTCTAGCAATTTTAGAGTGCTAGGTTAGGTCTTACATTATATTCTGAGACTCATTTT
TGAATGAGTTTTTTTTTTAACACATTTTTTTCTATATATAAAAATAGAATTTTGAGGGCC
AAAGAGATTGATTTAAGTCAGTGGTTCTTAACTTTCCTATTGCTGCAACCCTATAAGTTC
TTCATGTTGTAGTGACCCCAGCCATAACATTACTTTTGTTGCTCCTTCATAACTGTAATT
TTGGTATTGTTCTGAATTGTTATGTAAATATCTGATATGTATCCCCTGTGAAAGAGTTGT
GTGACATGGGGTTTTGACCCAATGGGTTGAGAACTACTGGTTTAAATGGTTATGAGAACC
TGCTGATCTAGAGGACACGTGTTCTGCTCCACAAGCTTACCCACCAGGCTCTGGGGATCT
GGCATACTCGTCTGGACTTTGGGAACACCTATTCACATTCACGTTTATCAGTGGATCTCA
ACCGGAGAGTCGTATGCCACATATCCTGCATATCAGATACTTACATTTCCATTCATAACA
GTAGCAAAATTACAGTTGAAGTAGCAAGGAAGTAATTGCCCTATTAGTATTCAGTTGTCT
TTTTTAAAACACAGTTATTTGGCTGTGTAGCATAGTGTCTTGAACTTGCTATGTAGTTCA
GGTGAATCTCTGATTCCTATCTTCCTACCTTAATGTTGGGATTAATGAGTATGTATAGCT
CATGTGACTTCTAAGAACCACCCCATCCATTAAATTTGCAGTTGGATTTGGTCTTGGCTT
CCTTATCTGACTTGACTTTAAAAGAACACAGGTACTCCTAAATAATTTAGTTAGGTGTTA
CTTTTGGATCTCTGGGTGTTGGCATTTGTCCCATTCCAAAGAAATTTGAGCTTAACCCAA
GGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGAT
GGATGGATGGGCTTTGGATCTGCCCAGCTTTCTGCCAGGTCTTAGGCTAAAGATGGAGGC
AACAGATTGGAGGTGTTTGTAACTTTAGGCTGTGAAGTTGGTAGTGCTTATAGTAGTGGA
CTCTTGATAAAAACCCATTTGCCTTGCTTTTTTGTAGATTTAAGCGCTATAAAAATGCCA
TCCCTCATCATCTATGATATCATGAATGAATTAGAGGGAAGAACATTTTCTCCACAGGAC
CTTGATGATGGTAGGTACAGAAATTGCTTGTGCTTTCCCCCAGCTCATGATGGTTGGTTT
GCCTGAATTCTGTTAGAGGCCTTATGTTTTGAGCAGTGTTTATTTAACTGAGTAACAATA
TTTAGATTGAACATTCTGAAAGAGCCAAGGGTATCTATAATATATTAATGTTATTGATAA
GAAAATAATGCTACATCTACACCAACCAAACTTTTTGTGAACTTTGGTTTCCAGGTAGAT
TTTTTCAGTTGGCCATGAGTGTGGTGAGTACCACTTTATTACTTTGTTATCCCTGCTCTA
AGGCTTCCTCTCTGTTCCTTGTTCTGCCTGTAACTGGGGGCTTCTGTGTGTCTCCTCTGT
TCCTGTTTTTGCTTCTACTCCTTTTTTCTCTACAATCTGTATCCTATCTCTATTACAGTG
TTGCCTTTTTTTATGCCTGTTTTAAGTTTTCAGAATATTTTTTTCCCATTAGCGTTGTAA
AGTGATGGAAATAGATTATTATGTTTGTTTTCATTTTATCATCACAGGAAAACTTTGATG
TTTTCAGGATGAGTAGAGAATATCCTGTTGATTGTGTGGCAGCCTAGTTGGTGTCTGTCC
TCTGGGCTTTTCCTCTGAGATGGCCACGCAGATGCAGCCTCTTTGGTGTATTTTGCAGGA
TAGGTGATCAGTGGTATTTCAGTGCTGGTACTTGAAGCTGTTTCATGGTGATTTTGATAG
TACAGTGCTAATATAAATTTGTCTTAAATTTCATGAACCTAGGGTTTATTTTACCCAATT
CCTTCTCAGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTATCAATAAATTGAATCTA
GTGCTAAGTATTTATACAAAGCAATAACTTTTTCTTTTTTTACCCTGTTGTGCCATTGGC
TTATAAGACTGTCTGAGTAATACTGTTTGCAAATTTTCAGTGTTCATCTCTCAGAGATTT
AGAGCTTGCTTACCAAGTACACAGACTTTTAAACACGGGGGACAACCGGAAACTGGTCGG
ACATGATCCTCTACGTAAGGTATATTAGTAAGTATGTTACTTAATATTTTAAAAGATTTA
TTTTATTATATGTGTGCTTGTCTGTGTGTGTGTATGTACACACCTATGCAAGCATTCGAA
AACCAGAAGGGTACCAGGAATTCTTCGTCAGTCTCTACCTGTCCCTCTAAGGCAGGATCT
ATTCCTGGAGCTGGGGCTTGTGACTCAGCTAGTCTGGAAGCCCAGCAAGCCCATCTCTGC
CCTGCTTTGGAATTGCCTATAAATACTTGGTAGGAACGCCTGGTTTGTTAAATGCTTGCT
GGGATCCAAACCAAACTCTAGCCCTCATGATTTTGGACCAAGGATTCTTAACTCTTGAGC
CATCTTTCTAACCCCCTCCTTTCAGTTTAATTGCTAGATTCAGCAGTGGGAGGATCTTAA
AGACTGTATATCTTAGCTCTAGTTTTAGGTGATGGGCCCATTATTTGTACTTGTAATTGA
ACACTTGATAAAAGCAGTGGGGCTGAGGAAATGGCTCCAAGTGGGAGCATACATTTTTAG
GTTTGGGTTCCCAGGCCCCACTGGTGGTATGTGTTCTGTAAACCCACGATGAAGCAGGAA
GTAGATATAGGCAAATCTGTTGAAGACCAGCTCCAACAATGTTCAGCAATCCGAGGAGGG
GGGTGTGGGGGCTGGTGATAATGTAAAGCATGCACATGCTCACACATTTAGTGGTTAAAG
CAAGCTCCATCAACTTCACACATAAATATATACATGTACACACATACATGGTGGGTGAAG
CAAGCTCCAACAACTTTATACATACATACATTGGGTAGATGGAGCAAGGCTTAATGGCGG
ATGACATGCAGAGGGACCTACAGTGGGCAAGTGAGCTTCCTAGAGATAGCCCACCATCTT
ACACAGCTGCAATGGCTGTACCTCAGCCTTCATCTACAGATTACTTCTTGCTGCTGCCAT
GCCTTCTCATGCTTGTCATTGCTATATTCCTCATACATCTAGCAAGGTGTGACTGCCTCT
TGAGAGACAGCCCACTCTGTCAGGCAACTTTCCTGCAGATCAATATGAAAATGAAATTTC
CAAAAATAATATTGTTTAAATGAACTAATAATTTTACAGACTTCCTGATTTGATTTAAAT
AGTCTTAGGAAGTTTAGGGTAATTGATAGAAAGTTTAAGGAGATGGATTAAGTTGTTTTG
CCAGAAGGTGTAATAAAGTTAGAACTATGAGTGGAATGTGTGCCCTCCTTTGTAAAATAC
TGGGGGCTACATCTGTTAGAAAACAAATACAGTGAGTTTTCTTGCATTACAAACATATAA
TTGTACTTGGAAAAGAAAAATAGGCTTGGGACAAGGTCATTATCAAAGAAAACATTGTAG
GTTGGGTCTGAGTTCTAGGATCTTGTGATCTAGGGATGTGGCCATAGGTTTCAGTGTGCA
CTATGAAAAAACAGGGTTATGGATAAAGAGTAAGTAATTCTGTTATGAATATAAGGATAA
ATAATGATGATTAGTTAGTTTATCTGAACAAAAGATAGGTTATCTCTCTTGCTAAGTATA
AATTGTTATCAGCATAGGAAAGAACTTACTACAAACTGGATTGCTTAAATTTTAGTAACA
AAAGAATTATTGCTTTGGGGTTTATGGTGAACTTGTGGAAAGAAAGAAAAATGGGGAATA
TTAGTTAAGTATGAATTTCAAAAGAATAATATATACTCCTATTGTAATTTCCTTTTGTGT
AGTGATTTTAATTGTTTGTTTGTTTTTCAAGACAGGGTTTCTCTTGTGTAGCTCTGGCTG
TCCTGGAACTCGCTCTGTAGACCAAGCTGGCTTGGAACCTGCCTCTGCCTCCCAAGTGCT
GGGATAAAAGGCGTGCGCCACCACTGCCCGGCTTTAATTCTGTTTTGAGGAATGTTTTTG
TGGTGATTGTTTTTTAGAGATAATGTTAACTTGTGACTCTGAGGTTTTTCCTTACAGAAC
TTTAGTCTTAGGTGGTATAAAAAGACTAAGAAAAAAAAAGTTATTGGAGTCAGCTCATTG
GAGTTGTCTATCCAAATATGTATATGTGTGTGTGTATATGTGTACATTTATGAAGTTTGA
TCAAGCTTACTTGTTGAAGCTTACTCCAGCCACACATAGATATGTGTGTATACCTATGTA
TGTATGTATGTAAAGAGGTTGGCGCCTGACTCCATCTACCCAGTGTGTGAATGTGTATTA
ATATATGCGTGTAATATTTATGTATGTGTAAAGAAAGTTGCTGGCGCTTGTTTCGTCCAG
CAGGTGTGTAAGCATGTGCTTGCCTTGCATTGTCGCCAACCCCCAGCCCCGCCTTGGACC
TCTGAACACATTGTTGGAGGTGAACACAACAGTGGAGCTTCAGGTTCAGTGAGGTTTTGG
AGAGGCAGTTGAAGACGACATCTGAAACACAACTCCCACTCCTACGAGCATCTATAGGCA
GGCACACCTGTGTACATATACGCAGACAAATTGAAAAGTAGCAGTAATATTAAGACTAGA
CTCTTATATGTACATAGAGATTTTATTGTGTTACACTTCATGCCTTTATGTGTGAGGGTT
GTTTTTGTGTGTCCAGGTCCTTGTTTCCCCACTGAGTACTTTGAATACAAATGTTATTTG
AGGTGACTGAGAATAAGTAGTAAGCAGGGAGCCCAAAGTGTCCAGCTGAGGATCCAAGAT
CTCAGCTGGGAAATGTAGTAGTTACCACTCATTTGGTCAATCATTGACCGTTCTGACTTG
AAATTACATATTTTTTTATTTTGTGTGCACATGTACAGCATTGGGGGTGGGGGGTGCCAA
AGGACAACTTTGTGGAGTGAGTCCTCTCCTGCCTTTATTACAAGTACCTTTACCCATCTC
ACTGACCTAAAGTTGTAAACTTTAAAAATGTATGATTTAATACAGTAATAATTCTACTGG
AATTTCACTAATCATATCTTATTGTTACACACAGACTTTAATCTAAACACACTTTTTCTC
TCCACAGTTCGAAGTTTTTCAGTTTGATTTGTTCACTGGAACAAATTGATGTCACCTTGA
AGTGGTATAAGGACCTAATACCTTCAGTAAGGGACTTCATACTCATCTTTGTCTTTGTAG
ATGAATTTGTGAGAATGCCTTTTCTGATGGATGTTATAAAATCATGTTTGTATTTCTCCA
CCAGGTGTTCCTTCCCCACTACCAAATATTCATAGGTCTTCTTCAAGCATTGGATGTGGC
CAATAGACTAGAATTGGTTCCTCAGATTTGGAAAGGTTGGTGGCAGTTTTGTGCAGTGAC
TGATGATTAACATGTACATTTTAAGACTGAAAGCCTCCATTCTTTTTTTTTTAAAAGATT
TATTTATTATTTATATGTAAGTACACTATAGCTGTCTTGAGGCACACCAGTAGAGGATGT
CAGATGTCATTATAGATGGTTGTAAGCCACCATGTGGTTGCTGGGATTTCAACTCAGGAC
CTTCATAAAAACAGTCAGTGTTCTTAACCGCCGAGCCACCTCTCCAGCCTCCAAAAGCCT
CCATTCTTAACAGAGGTTAACACTTTTGTTAAGGTCAAACTTGAAGGCCATTGCTCAAGT
TATAGTGGTTAAGTTAAGTACAGGAAAATAAGATCTTTCTGATATCAGTGCCAGAGAAAT
TAGTACCAAAGTCCAGCTCTGTGTCTTACCCAAATCTCTTACACAGGCTGTGTTATACAT
TGACTACAAACATTTCTGATTGGCATTTGGCAACAGGTCTCACTGAATAGCTCTGATTAT
CCTGGTACTCATTTTGTAGACCAGCCTCAGCCTCCCAGAGTAGTGGAATTAAGGTTTTCT
TTAATTCTAATAAATAATTCTAATTTTAATCCTACTGGAGGATAAAAGTCAGTAATGGAT
AAAAGCTCACCAGGTGTTTTGCATTTGGGATATCACTGTCCTTTTCTCTTGCTTTAAGAT
AGTAAAGAATACAGTCATACTTTCCGAGATGCCCTAAGAGAAGAAGTATTGATGCTCATG
GCCAGGGATAAACATCCACCAGAGGTAAGGCTGGCTTGAAGCTCAAGCCATCATTATTAG
AGGAGTACTGACCTGTGTATCTTCTTAAGGTCCTTGTGGGATGTTCCACTGACAAATGTA
GGTTTAGGTTAAACACCTATTACCATTAGCAGAATACCACTCTTAGTGTTAACCTCATTC
CTGTAGTCCAAGGTGGGTACCAGGAAGAGTTGTGACAGTGAATGCCAGGTTATTTAATAA
TTATTTCATGACCTAGAGAGAGGACTCCTAGGAAAGGCACTTGCTCTTCTTCTAGAGGAT
CGGGAGTCAGTTCCCAGTACTTACATCAGGCACTCACAAACATCTGCACTCAAAATGCAT
TTACTTTACCACACACACATAATTAAAAATAAGAGAGATATGAGCTGGAGAGGAGGCTCT
GATTAAGGGCAACTTGTTCTTCTTCCAAAGTACCCTGGTTAGATTCCCAGCACCATGTCT
GTGCCTCCACTTCCAGGGAAACTGGCCTCTGCAGGCATCAGGCACACATATGCACATGCA
GGCAAAATGGCTATACATACAAAATAAGATTTTCTTTTTTATTTATTAGAATTATTATTA
TTAACACCACCACCACCTGGAAAGATGTGTCAGTAGATAAAAGTGCTTTCTGCCAAGTCT
GATGACCTAAGTTTTTTTTCCTGGGTCCTACCTCGAGGAGAGAAGCAATTCCCACAAGCT
GTCCTCTGACCTCTACACATGGGCTCTGGCATACTTGTGTGCACATGTATATACGCAGCC
GATCGATAAATTGAAACCTTTTAAAGGAAATTCATCGTAGCTTTCATACATGTAGTTAAA
TTGCACTATCCCAAGACAGGTGAAGGCCTCTTTGTTGCTGTGTTACTTGTGTGGTATGCA
TGTGATAGTTCTTGATTTTAAATTCTTGTCAGAACAACTAAACACTTCTGCTGACTCTTA
GAGCCTCTCAGCTTCAGGTTGCATTTGCTGACTGTGCTGCTGATATCAAATCCACATACG
AAGACCAGAGTGCCCGGCAGCCTGCTTTTGATTGGCCAGCCAACCCTTTACAGTATATAG
CTGTCCTTTTTTTAAGAGGTGGCAGAAGCCAGGAAGCCTGGTGAGTACATGTTCCTAAGT
GTACATGTTAACAGTAATGCTTAGAGCTGAAACATTTACTTGGGTTGATAGGTGAATATT
CTCTACAAACCTGAATATACATGAGGTTTTAGTGGACACTTGCAAATACCAGTTAAACAA
GAAACTTGCTAAGGCCAGTATGTGTGATGTACTTGAAAAGAGGATACTCAGGTGAGCTGA
GAGTTCTCTTTATTCCATACCTTTTGGCTTTCTGCATCTTATTGGGCAAAAAACTCAGCC
TCATTCTTCTGCCCCCGTGGTTCTGAGTGATGAGAGAAGCACACCTTTGGAAATGCTCTG
GTGATTCAGCATACGTGCTCCTCGTCCCCATCCCTGACCTACGTGTGGTCTGAGGACCTT
AGACTTCTGGCAACTGGTATTTCCAGAAACAAGACTATCTTTGGTTTGTGCCTCTATTCT
GCTTCGGTGTGTTTTTCCAGTGCTTCACTAATATACTAAATCTAGTCTTTCTAAGTGGAG
ACCTTAGGCTTATTCGTTTTTCCAAAATTAGAGACACCAAGATTATCTCTCCCTGCCTAT
GAATGTATTGGATATTCATGGCCAGTCCAAATATGCCTGCCAATTCTCCAGAATAGATGT
TTGAAACATGTCTTTGGCTTGTTAGCTCACTTAAATGGGACCTGTTAGCACCTTTTTTGT
CACAAAACAAACAAACAAAAAAACCAACAAGGCGTTTTTCATGGTCAGGCAGGTTGAACA
CACTATGAAGCAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAGTCATGGGA
GCTGAATGTATGTGTTTTGCCTCTGTCCTGCATGTGGCAGGCTGTTGGCATTCACATACA
TGAGACTGTTGCCTTAATCTGAGCCTGTTCTTCATAATGGAGATTTAGAGCAGACTGAGT
CAGGCTTTAAGAGGAGATTAGGCTAAGCCCAGGCTACTAGCTCTTCTAACCTGCAGTGTA
GGGTAGATTCCCTCCGTGGGGGATATAACTAGCACTTCTAAATCGGCTGCATCTCAGATT
TACCTGTTGAATTTGTGCACCCAGATTGGGAGCTAGTGGAGCCCACAGGAATTGAAAAAG
TTTGAATAGTTGACTTGTAGGTCACGTAGCTTCTGAACCCGAGAAAAGGATAGCTTGCTT
TGTCTAGCTGCCACTTGTTTTCTGTCAGCAGTCATCTGTTCTCTTCTTCCACAGGAAAAT
GTTGGAACTCTTCAAAAAGCACAAGAAGATTCCCAGGTAAGTTGAGGGCCTCAGCTGGTA
CAGGCTTGAGTTAGTCACATGGGCTTTGACTCTTGGGTGCGTGGTTGGAATTTCTTCACA
TGCCTAAACCCTCCAGTTAGGCAGGCAAGCAGTTTCTCTCCTGCCATTCAGGGCATTGTA
AGCCATCCTTTTCTCTATTCAGTGATCATTTTGAGAAGGGGGTGGGGTGGGGGGGTGGAA
TATAGAATGTTATCCTCTATCTTTTGTCCAAAGTTAATGAGAATTTGATTAATATATTCT
GAATCTCGTCTATAAATATTTGACTAAAAGTTATTAAGTTTGGTACACTGGAGAAATGGC
TCACCTTGCTGCTTTTCCTAAGGTTTAGTTCTCAGCACCCACATGGAGGCTCACAACCGT
TTCTAACTCCAATTCCAGGGGGTCAGCACTGGCCTCTGTGGACATATGGTACACCTACGT
ACATGAAGACTCTTGGATATATAAGTCTGCAGTAGAAAAGTGCATTGGGTACAGTTCAGT
TTTGCCTTCTTTTATACAGAAATGAATTGCTGGAGGAATTCATGGACACAGCGAAAGCAT
CCGGTAGCACTGCTCTGGCCATTGAGGTTGTAAAGCTGGCAAGTGCCTTCAGCTTGCCTA
TTGGGGAGAGCCTTGCCCAAAGAGTAGTGATGGATTTCACAGTTGACCCAGAACAAAAGT
AAGTCTATCTCCTCTTCTGGTGCTTATAGCATTCTCTCCTGCTTCCCTTACAAAGCCAGG
GTTTGGTGGGTGATGTAATGCCTGTTTGCTCTGTTACAGGCTTCATCATAAACATTTGGT
TTTTGGAATTTTTTCTTTGTTCTCATAATAGTTCAGTGCAGTTTGGGGGATCCTTTTTCT
GCTTTGAAAACTGCTATGACTGTGTATAATCAAAGATGCCAAACACCCTGACCCTGTGAG
CTGAAGTGTGGTATCATTTCTCTTCCTTACAGAGAAGCCCTGGGTAACCTCACTGAACTG
AACAGTAGCGATGGAGAAAGCAGCAGTGACAGTGACAGTGACGACAAATGAGAGAGAGAG
GTGGCTCACAATAGCTGCTGGAATGTTAGAAGTGGTAAAAATAAACAGATACAGGGCTGG
GATCCAATATAAGCTCTGTATTGTATTGTACTGGCCTAAACCTAAGACCCTGGGGTTCAT
CTGCAGTACCGCTAAGATGCACATCTGGCCAGTTTTTTGCCAAGACAGCAACAAGCATTG
TGAAGTCTGACTTTTGGAGAAGAACAAATTCCACATAAACACACTGTTTGCAGGCCTCAT
TCCTACTACGCCCATCATGTTAGAACCCACAGGCCCTTGCTGCCTACCTGCTCTGTGATG
TGTGGTCCTTTGGCCTAGAGACAAGGATTCAAACTGGTTTTCATGGAGATGGGTTATTAC
TGTTGAGTTGATCGTATCCCGTTTTGAGAGTACTTAAAAAGATGGATGCTCTTAGAACTA
ATTAAATCAGAAGCAAGCTACTGGTTTAGGCTGCCCAGATGGTAAAGTCATTAAATAAAG
CAATTGTGTTATTTTTAAAAATCTAATTCTTTGTAAGCGTGTACATATTCACATGGATGC
CAGAGAACAATGGTTATTTCTTCAGACAGGCCTTGAGACTGCAGGTTCAGTTAGACTGGT
TGGCCAGCTCTGGGAATCCACCTAAGTTTCATACATACACAGTTTGTCATCTTCTAACTA
GAATACTCAAAAATTTTAGGGACGATTTGTACAGCTCTTGGAATAGAATACCCAAGAATG
TTTAGGGGATAGGAGTGGTACAGCTCTTGCCTAAGATGATGAGGTCATCCATTTCCACCC
CACTGCCACAAAACATTTTGGTCTGTGTGGGCACTTTATAAGTAAGTATTCAAAGAGATC
TGGAGGGCTAGTAATGACAAAAGGATATGAAATGTCGTAACAGTATGTTGCCACTGAGCA
ACTTGGTGTGCTTCTTGTAAATGATACTAATGGAAAGGAGTTACAAATTTGCGGTTTGCA
GGGTTCACCAGCCCATGCACTCACTCCTCCCAGGTTTTGCACTGAGAAGCAGCTTCATCT
GCCCTGCCTGCATCCATGGTTACAGATACGTGCGGTATTTTTATCTATTCTCATGCTAGG
GCCCAGTCTTCATCTTCAAAAACTTTGACACTCTTGTCCTACTCACCTACAAAACAGGAT
CTTAAGGCATTGGAGTGATGTGGGGTTGAGGGGTAGATGGAATGCCAGTTGACTAATTAC
CCACAAAGCAATTTTGGTAAGGAACAGAGGGCAAATTAGGATAAACTGGCTGCCAGAAAG
GCTATCACCTCTGCCCATTGGCATCTGTACCTGTGGGTGGCAGTGCCTTTGTGGCATTTC
TGCAATGCCTCTTCTCACCCAGGACTTAACATTGGTTTGAAGCCAGATGAAGAAAACCCT
TGGGTGTGAATATGTAAAGGACTTTCTAATCCACTTGATATGTGTAACTTTAACATCTTA
ACAAACCATTACTGAGCATGAACTCAACTGAGAATGATTAGGGTTTACCTATATAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1917..1969, 2074..2110, 4620..4665, 6269..6337, 6803..6907, 8444..8567, 11308..11423, 12595..12650, 13771..13858, 14882..14942, 15391..15476, 16237..16381, 17244..17294, 20077..20169, 20394..20422, 21100..21206, 24187..24265, 24364..24454, 25138..25223, 26171..26319, 27534..27575, 28099..28257, 28532..29115
1023..1129, 1917..1969, 2074..2110, 4620..4665, 6269..6337, 6803..6907, 8444..8567, 11308..11423, 12595..12650, 13771..13858, 14882..14942, 15391..15476, 16237..16381, 17244..17294, 20077..20169, 20394..20422, 21100..21206, 24187..24265, 24364..24454, 25138..25223, 26171..26319, 27534..27575, 28099..28257, 28532..28607
NM_027275.3
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved