Mus_musculus Locus Rpl17
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl17
Mus_musculus
Rpl17
18
SNORD58, SNORD58, SNORD58
1582..1647, 1979..2043, 2404..2468
4905
ctctcaaatgctgggattaaaggtgtgtgccaccacgcccggcccaaggactggttttt
tttgttttgtttgttgttgttgttgttgttttgttttgttttgttttgtttttttgaacg
acacaatgaacaacatgagtttattagctctgattgttttttagagccgttgtctttttc
ggtgactctagttggcctctagcttatgattgcctcagcctcctgagtgaacaccttgga
tttcactcaaacctcccaagtggccactatttcattctgaatactatcttctctttcatc
ttttaatttcgtttttacttttttagatttaagtaaaggaaaacaatcgaatcagcgttc
tgcggattaatttatattcccaattctctagtttcacacttgaatctctatcaacattat
caatgttaagtccttaacattctactgcctccctggtttgcccctgaacacaacgaggat
cacctcttacttttccatcagcggggagagaaagacaccggcacctgttgtcagggaggc
gcagactaggactggtttttataaaccagtctttcatctttttgtggtgacggggtttca
tgtagtgctgactggcactgaattttcatttaaataaataaatagttaaatgtaaaaatt
agattatttattttatgtgtatgagtattttgcttgcgtgtgtgtgcaccacgggtgtgc
ctggcacctatcgggtcggaaggcatctaattcccaggaactgaagttacctacgcgagc
tactgtgtttgtgcttcgtgtgtcctacgcttcatgactgtctttatttactgtcaccta
aaacccatacattttaatttcggaattaaaaataaaaaataaaaaagaaagttcctaaag
acgcacgcactccttttcaaactttctaaaagcattccacacttccttccttcgcggccc
gcccactcctcagatctcgttccttgggctggaagtctcgcGAGAGGTCGAGGTCTCATG
AATTCTCCCAGTAGCCTTCGCGCTTCCTCTTCCTGTAAGCGGCCAGAGgtgagtgctaac
tcggcgccgggctctcggggcgaatcctccgccatcgttgttgtcgtggctccgggagcg
ctggggcgtcgccatcccggcagctgagctccaagggccatgggtcctcgccgcgggtgg
ccgtgctctgcgtggaggggcgcgcgggcgcctccgacttggagccccggggcgtgcagg
ctgcggagcagcgagagggggcgggcatgggtgacggggccaggccgccggcggagctgc
ggggggctcggaccggacggggacgcccgaggctcggcttctacggtgaggggtggccta
ggacggagcgggagtgctgagatcggcgcccggtggaggctgcgaggtcgggggcaggag
gggtccgcactgctctgtgcctaagcctgaaactggagaggcacggggtgtgatggggaa
gggtcgaccgcgtactgggcggttaccctgacacccacaccccccccacacacacacaca
ccaaaaaaagggaaaaagatggctgcgatgatgtcatatcttaggacacctttggattaa
tcatgaaaataactatcctctgagcagctgttggtagtttcacccttccttggttaatag
ctgattgtgttagttactagctgctgtgttcacagGTCACCTGCCAAGATGGTTCGCTAC
TCTCTTGACCCAGAAAACCCCACAAAATgtaagtgacagacaaggacaagcttctgtttt
gatgtgtgggttatgctgtttgttgggggggggtgtttattatgcaacaaaaacggatct
ctcttcgtttgcagCATGCAAATCAAGAGGGTCAAACCTTCGTGTTCACTTTAAGgtaag
gaaggcgtgctcttgttaaggaatcctagtttgctcctgaacttggtcttaaaaggtagc
tgcagtgatgactatcttaggacacctttggatttaccgtgaaaagaagtaacctctgag
cagccacctttatataaatggatcgttggggtggggggtgctggagtaaaactcaccact
ggtgtggaacacgggtgtataattagcttacttaactggatttgtctcaaaatttaattc
tgttaacctaacctttctggcttctattagAACACCCGGGAAACTGCCCAGGCCATCAAG
GGAATGCATATCCGCAAAGCCACCAAGTATCTGAAGGATGTCACCTTAAAGAAGCAATGT
GTGCCATTCCGGCGGTATAATGGTGGAGTTGGTAGGTGCGCCCAGgtgagaaatcttgaa
agtatggtgttgcacattttaaggaagtgggaaagtgggctatagtcttgtaccgtcagt
tgggttgctgtgatgactatcttaggacacctttggattaaccgtgaaatcaaacaagtg
ctgagcaaccttggtgctggccgtagtagttaactggttctcgtactgattcatcacggg
cagtaacaagctgctttttctctttcagGCCAAACAGTGGGGCTGGACACAGGGTCGGTG
GCCAAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAATGCTGAGAGTAACGCTGA
ACTTAAGgtacctgagccattgctgttcttttgttacacctacaccttgaggtcggtctg
gtctacacagtaggaaactgtcttttagaagaaagccttttgtcttgtgcctctgtctgg
tattacagaatattacataaggtttagcatcgggtgtgctatgtcctaatagttacctcc
actcgttgtataaaagaagcattttctttggtctgagggcttatagcagatcagggtgtt
gtaccccaaaagaaacattttcatttaaaaagaatgtgtactgtttgatggcagtgagac
ggggcaaccatctgtttctagtcaccttaagggttacagacagcatctatttaacaggct
aaattttatggtaattgaatatctttaatgccttgagttagtgacctatgcaaagtgaca
ttctttgcactcaggaagataaagcggggtgaacaaaaagttcaaggtcatccaagttag
aaactggcctggggtattgaacttaagctgtattgaaaagcttgcctggtttctcccctt
tccagGGTTTAGACGTAGATTCTCTAGTCATTGAACACATCCAGGTGAACAAGGCACCTA
AGATGCGCCGACGAACCTACAGAGCTCATGGCCGGATTAACCCATACATGAGCTCCCCCT
GCCACATTGAGATGATCCTCACTGAGAAGGAACAGATCGTTCCAAAGCCAGAAGAGGAGG
TTGCACAGAAGAAAAAGgtaatggctcagtgttgctggagagacatgtggtgtgtggtga
ctgccttaggacatatgccattgtaattaccatgaagggaagtgtactgcccagtcctta
cccactttaatgtggcttctgtggcatagcactgcagaacctctgtccccactggatcag
tcatggcctttggtgtctctacaaccaatttgaccttttttgcacttgggcctttgtcct
tgatccttagtcttcagcttttgagctttccctgtttgcttaggtatgaatttgagtcca
agatttgatgtttgttctagtccagaaacttaaatggttcctttgtcttccttctcagAT
ATCCCAGAAGAAACTGAAGAAACAAAAACTCATGGCCCGGGAATAAATTCAGCATAAAAT
AAAGGCAGATAAAGTTAAAGGTCTTCTGGTGGTCTTTAATGAGCCCTGTTGGGAGTGAGG
TGCTTTAACATGGAGAAGCATGTTATTAAACAGTGAAATAGATGGTTCAAAACCACGTGA
CCATGTaaatatgactgtctagtagctttattgaattggcaaaaactgtaggtataaagt
gtttcatccataaactattgggtatatgataagcctgccttgggaaaggaattctttaca
attctaattagcttaagactttttgcttgtattttttttttttttttaggaaagggtggt
atttttatgtgtttcacttgttttgtgtatgtagtcctggctggctgtcatcagttaact
ctttagtgtctccttaaacatacgaacatcttagtgatttgagggggaagacacccacac
atgaaagttttctatctctgttttagaagtgccatttctttgccacccaaacagatgcat
acatactcttgaactggtttttaaaggctgcggagaaaggtcgtcatcagtgtgcatact
gttcttcaacgagcctcttaagctccaggggctgatacaatgttctgcctgcctcagcca
tacaagaaaaattacagggagtttatccctcactgccccctaccttgcttacagctggac
ttaagaatgaacaagtcacttgggaggcaggggcaggtggatttctgagtttgaggacag
cctggtctacaaagtgagttccaggacagccagggctgtacagagaaaccctgtctcaaa
agttttcaagtcatgcatcccgcttactgaaaacctatctgtactgcacccctgaactat
tttctgtatcttacttgcctatttagggcgctaataaaatcccagttagtatgtagacct
ttgggagcattttttagatgtgtgcttgccccataggttttaagtggaagaatagcttgg
ggtaaaggttccaaacctagatgtccaggatacaaggtgagataagggaaactagcctcc
cagaatgtgatcttttgatcctgtttagcaacacagtgactcctttgaaccttttgtgta
caaagctctgtaggaagagtggtttctcttcaggtgcaaagtaact
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1715..1767, 1874..1914, 2190..2324, 2548..2646, 3185..3376, 3718..3905
1728..1767, 1874..1914, 2190..2324, 2548..2646, 3185..3376, 3718..3765
BC003896.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved