Mus_musculus Locus Hspa9
snOPY snoRNA Orthological Gene Database
Mus_musculus Hspa9
Mus_musculus
Hspa9
18
SNORD63
12632..12701
18706
TTGGGTGGGGTGGCGCAGGCCTTTAATTCCAGCGTTCTAGAAGTACACTGGTGGGATCA
AGGCCAGCCTGGTCTATAAATCTAGTTCTGTGACAGCCGGCGCCCGCCATTCATACCCCG
TCGGAAACCTTGTCTTTGAAAAAAAAAAAAATCGTCACATTATAATCAACATCTGGCAAG
CGCAAGGTTTGAAAAAGAGGCGCCCCTGGCCTTGCAAACCGGGCAATAAGAGCTCATGTA
GTTCTCCCCTCATCGTTCCCAAGGCAGCCTTAAAAGTGACTCGAAGCTTCGTGAATCCGA
TGCTGCCCTAGAGCTTAGGAACCTAACCCGACCGAAGCAATGCGCTGCCCAAATTTGTGT
GAGACCGCGCACATTCAGGTGTGCACATTTCAAGCGGCGAACAAACAGCGATGGAGAACA
AAGGTCCCCGAAACAACGCCTCAGGACAAGATGGCGACCGCAGCAAGTCGCGGCCTCCGG
GGACAACGCCCACGCGCCTGCCAGTGAGCGCGCGAGCTCGCGCCCCCGGCACTCGCCCGC
AAATTCGCGTGCACTGGAGCATCCAATAAACGCTACAGTTAAACCCGAACCCGTTTTCTC
CACGCCCCTCACACATGCGCTTCACGACCTCTGTCCGGAGCGGAGAACGCAGGCGCAGAA
CGCACCTCCTTCTGCGCAACTGACGCAAGGAGACTGTAATCTGTTCGTAATTTATCCCGT
GTGACCTTGAGTCTTTCCCGTCCTAAGGACCGGGACTGTCCGAAGCGATGCCTGTCCACC
TCTCTTCTCTCTTTCCCTTCTCCCTGCTCCCACAGCCCTGGAAACCGTGATGAGAGAACG
GGAACTTTCAACGATTAATGCTGAGAGGCGTGCTGGCGGCGTGCGCCGATCCCGGGAGCA
GCGGACACGTAGTCTCTAGTCAGGCAGCACGTCGGGCGCCTCAGCAGAAGAGCGGGCTTC
ATTGCTGCAGCGGCCAGCCCCCGCCCCCACCCCACGTGGTTGGAGGTTTCCAGAAGCGTA
GCCACCACCGTGCACGCAGCTCCGGGCCCGTGGGGTGTTGGTTCTTGCCCTCGTAACCCC
CTCTGTCCAGCCACCATGATAAGCGCCAGCAGAGCCGCGGCCGCGCGTCTCGTGGGCACC
GCTGCGTCCCGGAGCCCCGCAGCCGCCCGTCCCCAGGTGAGAAGCTGCCATGCCTTCCGG
TGGGGGCTCCAGGCCCGGACTCGAGTGAGGCAGGCCTTGCCCTTCGGGGTCAGACTCTAG
GAAAAATCCGGAGCGAAGGGATGTAACGGACCTTCTGTGGGCATTGTTGGCCTTCTTGCA
GGGCTTTAGCTTCGAACTGTGCTGAGTCACAATCCTTGGCGTTCCTAAGTCTTTACCCCG
CTAATTGAGGACGTCTGGGTCCCCCCTCTAACCTGTGGCGCTTTGAATGTGCCTGGACTT
AGGCAGTGGACGTAGTTTACTGGAAAGGCAGAACTAAGCACGGAGAGTCGATGGACAGGT
TCTGTACTGTAAATATTCATGAATGTCGCTGCTATGAAGAAACGGGGGAGGGTATGTACA
TTAGGAACCGAAAATTAAATTCCAACTCCATTCTTGGACGTTTTGCTTTATTATTTTTGA
GACAAGGTCTCTTTGTAGACCTGGTTGCCCGGGAATTGACTTTGGACTTCACAGAGACCT
CCCCCAAACCCCCAATCCCGCCTGCCTGTCTCTGTCGCACGGCGGCTGAGATTGAAGGCG
AGCACACCCGGCTCCAATGTTAGTGACATTTTTTTTTCCCCTTCTTACTCGATTTACTTG
TGGCTTATAATAACAAATAGAAAAAAGATTGTGGATCTTGAAATAAGAGAAAAGGACCTC
TTTGGAGAATGAGACCTGTAATTTTCTAAAGTACATAATAATTCATAAAAATAATAAAAT
ACATAAAAATAATTATCTGGTTGTTTGATCAGGCCAGTGGAAATGAGTACCTTAATTGAG
GCCAGGTGTACAGGGTTGTGAGTTTTATTTTGAGATAGGGTCTCAACAGCCTTAGCTGTT
CTGGAACTTACTAGACCAGGCCTGCCTCTGGCCTGGAAATATTAGGATTAAAGGCATTTG
CCATTAGGCCCGTCAACTGAGTTTTCAATTTTTTTCGTGTGAGCTTAAACAGATCTTCAG
AGGAAGTGGTTCCCAGACACACACACACACACCCTACACACATGGGGTTTTGTGTGCAAG
CAAGGCAAATCTGCCAGCTTCCAGGTTGTCCTGACTTTGAGGGACACTTAATTTATGGGT
TTCTTGTTGGTAAAGGTCAGAGTTGCTTCTAAGCATCACATTTCTCGGTTTGTCACAGCA
AATATTGGTACAAGATCAATAATGTCAAAGTTGGAAATCTATTGGCAATGTAATTTTTTT
ATCTCTGGGGAGGGGGAGCAATTCAAGACAATTTTATGTATGTTTAATTTTACCAGACAA
GTCTGGAAAACTTGTAGATGTGTGATGTATAGCTCAACCTATGTATTTTACATACTAAGG
ACTAAAGCTTGCATGTGTTTCTCAGAATAATTGGAAAAAGCCCAAGTTTCTTTGTGTAGT
TGATGGCTGATGCAACTTTTTTCCCCCCAGGATGGCTGGAATGGCCTTAGCCATGAGGCT
TTTAGATTTGTTTCAAGAAGAGATTATGCGTAAGTACAACCTCAGTTTCTCTGAGAAAAA
AAAAAAAAACACTTATTGAACCTCAAAGCTTGGATGGGTTGGGTGCGTTATACATTTGTA
CTTGTAGTTTATTCAATATGCCACTGGTAACACCAACATAAAACACAGTTCTTCGTATTG
GAGACCACTGTTCAGATGACCATGGAATTTCATTTCTTACAGATCAGAAGCAATCAAGGG
TGCAGTGGTTGGTATTGATTTGGGTACTACTAACTCCTGTGTGGCTGTTATGGAGGGCAA
ACAAGCAAAGGTGAGCATGATTGGAAACCTGAGGTCACTTAGATACCCAGTCTGGCATTA
AGTACATAGGAATGCTGAGTCGGAGCCCAGGTTAGTGGTGGGCACCTTTAATCCTAGTAA
AGGCAGAGGGATCTCTGAGTTCAGGACCAGCCTAGAGTACAAAGTGAGTTCCAGGACAGC
CAGGGCAACTCAGAGAAAAACCCTGTCTCAAAAACCAACAGTGGTGAATTTAGTTTGGTG
CTGGTTTTTCTTCGAGTGACTGTATCCTGGGCCAGCCTCAACGGTGCAGTATTCTGTGCT
AAGATTACAGGCATTGACCGCTCCAGACTTCTAATTTGCATTTAAAGGCTGCTTTTGCTT
TTTTAAGACTTGGGAATTAACCTTTGGGTGTTCATAATTGAGTGGGTTTAGATTACAAGA
GTACTATTTAAACATGTCATTAGAGGACTTGAAATGGCCTGCTCTGTTAGGAGTCCAGCA
AGACTAGAAGCTTCTACTTGCTAGAAACAAGGAGAACTCCCACTTTTGTGTTCTGTAGAG
GTTGTTGAAGCCTCTTCAGCACAATACACAAGCTTTTCCTGTTTGAGTTGTCAAGACTTA
GAGCTCCTGGGACTCTACAGTTGTCTGTTTTACCCTTGCTGCTTTACCAATACCTGGGCT
GGCTACAGGCTGGAACCCCACCTGTTTGATACTAAGATAAGCCCTTACTTAATCCTGATT
TATGCTGCTCAGTCTATTTTGTTCTCTTTGTCTAAAATTTTAGCTTCTGTATACTTAACA
AGAATAGGCTTAATAAAAGTGGTATGGCCATAGGCTTGTGGACATATTTGAAATATTTAT
CATGTAGGATTCACAGCAGTAAAACATGCCAATTTAGTGCATCATCCATTTAGTTTTTTT
TTTTTTTTAATATGATTCAAGCCATGGTTGTATCTTAAGTCATGGTTATAGAGATTCCAG
TGGTGATTAGTACTTTAATCAGTGTCTTTGGGAATTTTAGGTCCTGGAGAATGCTGAAGG
TGCCAGAACTACCCCTTCTGTGGTTGCCTTTACAGCAGATGGAGAACGACTTGTTGGTAT
GCCAGCAAAACGGCAAGCTGTCACCAATCCAAACAATACCTTCTATGCTACTAAGCGTCT
TATTGGACGACGATATGATGACCCTGAAGTACAGAAAGACACGTGAGTAATAGGAAAATC
AGTCCAGAAGACTGGTGCTTTGATCAAAGTTCTGTGGATACCTTGAGTTCTGTGGATACC
TTGATCACTTTTTCATTATTTCTCTTGGGAAGAAATCACACCACCATCAGAGGCATATAG
GTTTTTTTTTTGTTATTTCTTTGTTGTTGTTGTTTTCCTATTTATTTGTTTGTTTGTTTG
GGGGGGGGTTTCTTTGTGTATTTTCCTGGAACTCATTCTGTAGACCAGGCTGGCCTCAAG
CTCACTGAGATTCACCTGCCTCTGTCTCCCAGGTGCTAGGGTTAAAGGTATGTGCCAGCA
TCACCCGGCCCAAGAGTACAATTCTAAAAAGCCCATTTTTGCCTTCCCAGATTAGAGCTT
ACTTTGATTTATATGACAGTAACACATGATAATAACAGGTCATGTATTAAGATGCTTTAA
GTTGTCAGTGGTGGCACGCTCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATT
TCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGACTACACAG
AGAAACCCTGTCGTGGGGGTGGGGGAGAAGTTGCTCTAAGTTTGTGAGACATTCCTAAAT
TATGTAAGTCATCAGCAGTCATGTAGTGGAATAGGTCGTATCATGTTAAGTTGTGTGTGT
ATGTGTATCCACCCTCCTCCCCCTTTTTTTCTTCTAGATAATAGCCCTGGCTGTCGTAGA
ACGCATTCTGTAGACCAGGCTTGCCTTGAACTCAGATCTCCTTACTTCTGCCTCCCTGGT
GCTCAGACTAATAAAGGCATGGACCGCCACTGCCTGGCTTTTATTTATTTATTTTATTAC
ATTTTTGTTGTGTTTGTGGGTATGGTCATCCTCTGTCATGTGACAGGAGGCCAGAGTTAT
ACCTTGCACAAGTCCATTTTCTTCTACCATGTAGGTCCTGTCTGTTGAAGGTCAGGTTAT
TAGACTTGTTAGTAAGAGCCTTTGCTTGCTAAGCTATCTTCTTGGTCCTGTTTTGCACTT
TTTTTTTAATACTTATTTTATGTATATGAGTATACCATAGCTGTCTTCAGACACACCAGA
AGAGGGCATCAGTTCCTATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGA
ACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACTGCTGAGCCCCTCTCCAGCCCCA
CTTTTTTTTTTTTTTTTTAAAGTTGAGATTAAAAGTGAAAAATATGGGCCAGGTAGCAGT
GGTGTTACATGCTTTTGAGCCCATCACTCAGGAGGCAGAGAGGCAGGTAGATTTCTGAGT
TTCAAGACAGCCAGGGCTACACAAGGACATCCTGTCTTGAAAAAGAAAGAAATCCAAAAG
GGAAAGAAAAAGAAATAAAAGCAGACTGGAGACTGCTCAGCACTTAAGGGTGCTGACTTC
TTCCAGAGGATCTGGGTTTGATTCCTAACACCTATATGGTGGTTCACAAACTATTGGTAA
CTGTAGTTCCTGCGAATCTGACACCTCCTGGCCAGTACATAGACATGCAGAGTAAACACC
AATATACATAAAATGAGTAAAATTTAGAAAAACACCTCAAGCTTACTATTATGTGTGTTT
TCTTAGAAAACTGCTTTAAAAAAAAAAGAATTATTTACTTTAATTATATATGCACTCTGT
AGCTGTATCAGACACACCAGAAGAGGGCATCAGATTCCATTACAGATGGTTGTGAGCCAC
CATGTGGTTGTTGGGATTTGAACTCGGGACCTCTGGAAGAACAGTCAGTGCTCTTAACTG
CTGAGCCATCTCTCCAGCCCAGGAACCTGCTTTTTTTTAAGCTCTGGGGATGAAGTAGAC
CTGGTTAACTTCAAGTTACTCTAAGTCAGTGTTCAACTTCTTCCTTGCATCTGTACTTAT
TTTTGTGACCAAGTAATATTGTATGGACATTTTCTTAGAGACTATCTGGTCTTTTACAAT
TTAAAATACATGTGATATATGATGAACTTAGAGTGGTAAGTTTCACAGGGATAGTTTACT
TACATAATTCTTTCTGTCTTTAAGTAAGAATGTTCCTTTTAAAATTGTCCGTGCCTCCAA
TGGTGATGCTTGGGTTGAGGCTCATGGAAAACTCTATTCTCCAAGTCAGATTGGAGCATT
TGTGTTGATGAAGATGAAAGAGACTGCAGGTAAGTGGATTTATTTCACATTTAGGAAAAT
TGGATGTGCTGTTTATTTCTCTGCATTAATACTGATTAACTTCATATTCTGTAGATAATG
GAGTCTGAAGCTTTTTGCATAGAAAATTTAGGAAGGGTAGAACCTGCAGATTGGGTTTAA
CTTTCGTGCTGGGCTGGTTGTAGGGTGCACTGTAGTATTTTGTGTTTAAAAATCAGAAAG
CTACAAGTTAAATTTAAGTCTAAAGGTCACTGGATATTGATTAAGTCTTGACTGAAATGC
TAAAGGTGATTTGGAATTTCCACTAACATCTCTGCTGTTGCACAAAAGCACTTCCCAGAC
CTTTAAAACATTTTTGAGGAGGGGGGCTCAGCAACACAGGCTGGCTTGAGCTTCCGATCC
TATAGTTGTAACCACCTAAGTACTAACATAGTTAGGGTGATTTGTTTTTCAGACCAAATT
TCATACTGTAGCCTAGGCTGACTTGGCATTTTGTAGTCAAGACTTGTCTCAGACTTGTAG
TGATCTTTGACCCTCAGCTTTCTAAGTGCCAAGAGTATACGCATGAGCTACTGTGCCTGC
AGGTCTTCCTTTGTAACCCGGGCAGCTTTGAATTCATGTTCCTCCTGCTGCCTCCTGGGT
GCTAAGTTGCAAGGTGATAGATACAGTACTCACTCTAGTGTCTTTCTTGGGGTGCTCTTT
TCCAAGGCCTCTCTACATATTAAGCCACAAAGGAGTCTGTTGCCCCTCAAGAGGATGAGA
TGTGGAATATTAGGCTACAGTTTTGTTGCCTTTTTTTTATTTTCCTAACATGGTACCACA
ATTGAATTTTATTCTTTGTTTCCCAGAAAATTACTTGGGCCACACAGCAAAAAATGCTGT
GATCACAGTCCCTGCTTATTTCAATGATTCACAGCGACAGGTAAAATTAGATCTCTTGTT
TGCTGGGAGTGGAGGTGGGGTACCTGAGTTAAAGGATGGAAAGATAGATTTATTTCTACT
TTCTCTAGGCCACTAAGGATGCTGGCCAGATATCTGGGCTAAATGTGCTTCGAGTGATCA
ATGAGCCTACAGCTGCTGCTCTAGCTTACGGTCTGGACAAATCTGAAGATAAAGTGTAAG
TTGGTACAGTACATATTACCTGATTTACAGGGGTTGTGTGTGTGTGTGTGTGTGTGTAAT
TTTACTACAATTTGTGTGGGTCCGTGTGTTGTGGTACATTTGTACCATGGCATGGATATG
GAGGTCAAAAGATTAAATGTGTGAACTGGTTTTTGACTTTCCTAAGGTAGATTTTGGGTC
AGGTTTTCAGATGTGGTGGCAAGTGCCTTCATCTTCAATGGTTCTGCTCTTTTGTTAAGA
AATGACACTTATTTTCAATTATTGATTTGTTTGTATATAGGTATATGCATGTTAATCCTG
ACACAGAGATGTCAGACTCTCCTGGAGCCCACACACACTTAAAATGTATTGTGTGTGTGG
TGGGTCACGTTCACAGCACAGTGCTCATGTGGAGGTCGGAACAATTTAGAGGATTCAATT
TTCTCCTTCCATGTAATTTTCTGAGATTGATCAGGCTTAGAACCAAAATCTATTTTGATG
GCCCTTGTGCTTGTTATTTGTTTTGTTTTGAAGACAGGGTGGTTCTTTTGTTTTTTTGGT
TGGTTGGTTGGTTTTTGGTTTTTCGAGACAGGGTTTCTCTGTAGTCCTGGCTGTCTTTGA
ACTCACTCTGTAGACCAGGCTGGCCTTGAATTCAAAAAATCCGCCTGCCTTTGCCTTTGC
TGGGATTAAAGGCGTGCGCCACCACTGCCTAGCTGGATACAGTTTCTTTATGTAGCTCTA
GCTATCCTGGAGCTCCCTTTGTAAGCCAGGCTATTCCCAAACTCAGAGATTTGCCTGCCT
CCCTCTCCCCTGGGATAAAGGTGTACACTACCACCACCTGACTTGTGCTGTAAATGTAAC
CTGAACTGTGAACTAAATTATGACAGCTATAACATTTTTCCTAGAGCATTACTGTTTCAG
AGGGTGAAAGTATTGTGCTTAGACAAAAAAAAAAAGTACTTTATTCTCTGCAAATCTGTT
TGTATGATCACTAATTCATGACCATTTTACTGTTCATTTTAGACCTTGATAGTTTTTTTT
ATATGTTGACAAATACTTTGGAAATCATAGTTGGTGTGTTACTAATTTTACTTGTTTCTG
TATGACATGCTTATATGATACGTTAACAGGCATGCCACTTAGGTTGATAACTACATTCAG
TTATTAAGTATTTCAGGAAATATCATAGTTAATAATTAAACTTTTGGTCTTTTAATTCGT
TCCTTTGTTTTGTTCCTTGGAACTTAACTTACTTATTTATTTTTTAGCATTGCTGTGTAT
GATTTAGGTGGTGGAACCTTTGACATTTCTATCCTGGAAATTCAGAAAGGAGTGTTTGAG
GTGAAATCTACCAATGGGGACACTTTCTTAGGAGGGGAAGACTTTGACCAAGCTTTGTTG
CGGCACATTGTCAAGGAGTTCAAGAGAGAGGTTAGTCACCACTGGTTAGTTACCACTGCT
TAGTCACCACTGGTTAAGGTGTAGGCGTTGGGTTGTTGAGAATTTTTGTTTGTTTGCATT
GCTTTTAGCTTTGTTAATAGCTTTTTTATACTAAGGTAACTAACTATACTTCAGATTCAT
GGGTAAACTAAACCAGTTTAGTTATATAATCTTAGATTGGGAACAAAAGACCAAGTGACA
GTGGTTATAGTATTGGAGAAGGAATTTTAGGAACTCTGAAAAACAAAACCTTGAGCTTGG
CAGAGTTGATGGGAGTTCAGTCTACTGACATGGGTCCGATAAATTATTATTTGGTTATTT
TCTACATATCTTTAAAGGTGATAATTTGTATTTCTTTATAAAGGATTGGCCCCTTAATAA
GCAAACAAAACATGTTCTACATCACTACTGCAGTTCTATATTAATTGTCTCACTAATCCT
ATTTTATAGACAGGGGTTGATTTGACCAAAGACAACATGGCGCTTCAGAGGGTTCGGGAA
GCTGCTGAGAAGGCTAAATGTGAACTTTCCTCATCTGTGCAGGTGAGGGATGGAAAAATC
CCAGTACTGAGCATATTTGAATAGTGTATTCTAATTTACCTAATGTCAGTGTAGCTCTTT
ACAGTTTTCTGTTGGCTGAAAACTTGGGGCATGAGCAAAGGAACAACTTGATGATCAGTT
CTTTTCATTTGAATGAATGAAGTAGATTTATGGATGTGTGTATCTTTTGCCTGCATGTGT
GTCTGTACTACATTTGTGCTTGGTTTCTGTGGCGGCCAGAAGAGGGTATCAGAACTGACA
TGTCAGTGTTGGGGATTGAACCTGAGTCTTCTTGGTGAGCTCTTAACTACTGAGCCATCT
GTCCATTCCTGAGCTAAAAGATGATACAGATACACTAGAGCCAAATAACAGTCATGCTTC
TGGGGGAATGACATTAGTAACATTAGTAATTCACTTTTCTTTTTTTTTTTAATTTTGTTT
TGTTGTTTCGTTTGGGTTAGGGTTTTTTTTTAATTTTTTTTTTTTTAAGATTTATGTATT
TATTTACATGAGTACACTCACTCTCTTCATCAGAAGAGGGCATTGGATCCCATCATAGAT
GGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAATACCTTTGGAATAGTAGTCA
GTACTCTTAACCACTGAGCCATCTTTCTAGCCCTTGGGTTTGGTTTTTGCTTTTGTTTTT
TAAAGATTGATTTATTATTATATGTAAAGCACACTGTAGCTGTCTTCAGATACCACAGAA
GAGGCATCAGATCTCATTACAGATAGTTGTGAGCCTCCATGTGGTTGCTGGGATTTGAAC
TCAGGACCTCTGGAAGAGCAGTCAGTGCGCTTCACTGCTGAGCCATCTCTCCAGCCCCCT
CGGGTTAGGTTTTTGAGACTGGGATTTTCTGTATAGCCCTGGGACACTAGACCAGGCTGA
CCTCAAACTCAGACCCACCTGCTTCTGTCTCCCAAGTACTGGGATTAAAGGTTTGCACAA
ACATCCCTGGCTTGAAGTAGCAAGTGTTCTTAACCACTGATGTCTCCAGCCCACTCCTAA
GGTTCTTAGCTCTGTGAATTTGGATGAATCGTTCCACTTTTTCTTCTTAACCTACAACTG
AAGCTAATGAATGGTAATTTTCTCTTACACTTGAGGTTTACCTTCCTAAGGAAACTAGTA
AATAGTAAGGACTATGCATTAAATATAACTTAAAGGTGACTTATATCTGTAATCCTAGTA
CTCTGAAGGCTGAAGCAGTTTTAAAGGAACCTAACAGCAGGGTGTGCTGGTCACAGGAAG
ATAAGAGTTTAATAAGGTCAGCCTCACCTGACTAGTGAGACCCTTGGTGTGTGAGAGAGA
GGTTTGAAGCTGAAAAAACATCTGATGAGGGCATACAGCATGTTAAGGACAGGACAGTTT
GAGGTGGTAGGGAAGAGATAATTTGTGGAGAGTAGTTGCTATCCCCCACCTCCCCACCCC
CTTTTGGTTCCCAGCACCTGCTTGTAACACCAGTTCAGGAAAACTGACACCTTCTTGCTT
CTTTAGACACCTGTACTTATGCAGTACACATCTATATACGTTTAGGTAACACACTTTTTA
AGAGAGTTTTGGAAAAAATTCAATGTGGCAGATTGTATAAGGCTCAGGGGTAAAAGACCT
GGGGTTGGAAAAGCTGAGTGCAGATGGAGGAGATGCTAAACCTAGACACAGATGTGGGTC
ATTAAGTACAGACCCCAGAAGAATTATTAAACATGGTCAAAACATGTGAAAAAGTGTAAT
AGAATGGAAAATGTTTCTTAAGGAGCTGTGGATTAATGAGAGTTAGGTGATAGAGTTTAA
AAGTGAGGAAGGAAGGCAAACTTTGTCATAGAATGACTTTGTCTTAAAAGTAGTCCCATG
CCGAGTGTAGTTCCACTTGGGAGACAGAGGCAGGTGAATCTCTTAAAGTCTGAGGTCATC
CTGCTATATGTAGTTCCAGGACCCCCAGAGCAACATAGACCCTGTTTTAGACACACACAA
ACACAGACAGCTGTTAATCCTAGAAAGTCCTCAGTAGTTACATATGGCTAGTGATCGCCA
AATTGAACGACAGTTTCTGTTGACAAAACGGCCAGACAGCATTGAAGTTATTTTCTGATT
TGTCATTGAAGTTTTCAGAGAAATTGTCATTATTCTTTCAAGCAATGTATATCGCCCTTA
TTTATATAGACAGTGTATTTACTATGAAGTATTTAACTGTGTAAGGTAGCTTTTCCTGTA
GCAAAGTGCTTAAGAACTAGCTTTTCTCAGGTTGTATATCCTATTAGCCTTTGATAGAAA
TGCAAAGCAGTTTGGGAGAGGGGGGATCTGGATGTGTACTTCTCACACAATGTTCATAGC
AAATTCTTTGAATTTTGTTAGCCTAATTTTTTTAACTGTGTTTCTAGTTGTCTAGTAACA
TGTATTTATTTGCTATGAAACAGACTGAGTGCTGAGATTAGATATGTGCTATATATACTC
TTCAGTATATACTAATTATACATAATAAATTTTATTAAGATTTTCACACAAATATATTTA
CCACATCGAGTCTAAATATCCTTGATTGCATGTGCTTTTCAAGTCCGTGGTTATGGTTAA
CTTTGAGTGGAGTATCAAAGTACCAACCGTTCTCCCTACTGACGTGTGGTTCCTGTGCAG
ACTGACATCAACTTGCCATACCTTACCATGGATGCTTCTGGACCAAAGCATTTGAATATG
AAGCTGACTCGAGCTCAGTTTGAAGGCATTGTCACAGATCTAATCAAGAGAACTATTGCT
CCGTGTCAGAAAGCTATGCAGGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATT
CTGGTTGGTGGCATGACAAGGATGCCCAAGGTATGGACTCATGGTATTTCTCCTAGAGGA
AAAAAATAACAATGCATTCTTGAGGCAAATGGCTTGTGTTGTGTGTGGAAACAAATGTGA
TCCATTCTTCTAGTGTTCTTTAAAGAGTGGTGAGACCAGACTCACCAAAAAGTGCTTTTA
GTCGCCTGTGATGGCTCATGTAGGAGGATGGCCTTGAGTTCTGGGTAAGATGCAGCTACA
GAATTCTACCTTGCACACACACTTAAACCCAGTCTGGTAAAGAGAAGTTGTTAAGCTTGA
TAGTAGCCAGTCCCTGGGGGATGTTTTGGACACCTTTTCCAGTAGTACTTGGTGGGGGGT
GGGGGCTACTTGAATTTCTTCAACAAATACTTGTGCGATGATGCATTTTATTCAACACAT
CATTCTGAAAATAGATGTGTAGAGAAATGATAACTGAGCACAGACTTGTTGAAGGTGCAG
TTGGGTTTTGGTAGCTAGATAGAATTATCTTACACCAAGTTAATGATGCATTTATTTAGG
TAGTGGTTTGTTCTTTTTCTCTCTTTGAAATGCATAGATGTTGGAAAATGAGCCCAAAAT
AAGACCCTAGGATTCTGGTTTATTCTGTTATTGATATTAACAAATTCTCCTAAGATGCTG
TGCACTTTTGTTACCTCTAATACATAGGCTCAGAAACTATCCCTCATTTCAGATGTAAAA
TTGATAATACTTCTTCCTAAGATTGGGCGATTGTGTAGAATATGAGAACTGTATTTTATA
ACCCCTTGTCATGTGCCTTCTATTTCAAATGATATCCTCTGGGAAGCTAGATAATTAAAT
TCTTCTCTCATTTAAGTGGACAGTGGATGAGATGCTCTGAAGTTGTCAAATACAAACAAG
TCTGCAGTCTTGGATATGAATCTCTCTGACTTGCTGTCTGGCAGGCGTATTCTGTTTGGC
TCCATCAGTCGCCCTGGGTGTTGGCTAACAGGTTCTTTCTCCCTGATGCTTAGGTTCAGC
AGACTGTACAAGATCTTTTTGGCAGAGCCCCGAGTAAAGCTGTTAATCCTGATGAGGCTG
TAGCCATCGGAGCTGCCATCCAGGGAGGTGTGTTGGCTGGTGACGTTACAGACGTGCTGC
TCCTGGATGTCACTCCCCTCTCTCTGGGTATTGAGACTCTGGGAGGCGTCTTTACCAAAC
TTATTAATAGGAACACCACTATTCCAACCAAAAAGAGCCAGGTAAGAGCCATTCTTTTTT
CCTGCCTATTAACAGTCCCAAGTTGTACAAGTGCTGTTTACAATCACTTTATGAACTCTT
TAAAACTTTGTTTCTAAGACTATACTAACTGGACTGGGTGTTGAGACTATGTATTTTGTT
TTTTTCCTCCCCCTTTTTTTGCAGTTCCTAGAAAAGTTAGACCTCAACTAGCAGTGGTGA
AAGATGATGCAATTTCCTTAAAAGGCTGTTGTCATTTATTACCATATATTACCATAGTCC
TTGTAGTCTTCTGTTATCAAAAGCAAGAAAAGCCTGGGGAGGGACATGGGAGTAGGTTTG
ATTTCTGGGCGAATGATGGGCTGTGTTGTACACCACCAAGTAGGGACATATGGGTCTGGC
ATGGTCTCAGATGAAGAATTACTTCTTGTGGCTGGTAGATTATTCCAACACTTGGGGATG
TTGAGACATGAAAATTCAGAGTTTGAGAACTGCCTTGGACCATGTAGTGTGGACACGTCT
CCAATATTTTATTTCTATACTAATTTAGTTGTCAGTTTTTCTTGAGCACTCTAGTTCTGG
TGTTTGAGCAATGATGTATTTGTCACATCATTCTGAAGGAAAGTTTGTGGTGACTTGTTA
TTACTGAGCACATGGTACATTGTCTGTCTCTAATCCTCCTTCCCTGGACTAGCAAACCAG
TATTTAAGGTCTTGTTTTGATGCCTTAAACGTTAAGGCTTAAAGCCTCACCTTGTATAGC
TTGCTTAATTAGCTGAAGCAACAGCTATTGTGTGTCTTTTTAAATTAATCCTGTTCCTGT
CCTTTGTTCTAAGAGTCATAAACATTAGGAATTACCCAGTGTCTGAATAAATTTCTCTTG
TTAGCCTTTTCTCTATAATAGGTGTAGTTAAATCAGATTATCAAGTTTTCTTTTTCCCTA
GGTGTTTTCTACTGCTGCTGATGGACAAACTCAAGTAGAGATTAAAGTGTGTCAGGGGGA
ACGAGAGATGGCTGGAGACAACAAACTTCTAGGACAGTTCACTTTGGTAAGTGTTTTGAG
TCTGAGTATCATGCTTTTGGGGTCTATAGCTTGCAAAGCTCCAAACTGCTGACATACAGG
CATATTGTGTTATTTTTTAAAAAGAACGTTATGTACATGAGTTATGAAACCCATGATTTT
AGTTTTTACCTAAAAGTGCTTTGTGTTTTCAGAATTTGAAATTTTCAAAGCCTGGGAAAT
GTTCAGACTCAGAAGCAATGCTAACTCAGAAGTTAGTTTTATCCTGATTACTCATTTTAA
AAAACTTAATAGCTACTGGTTCTGGTCAGCATTGCTACAGTAGAGAAGTTTATTTGCTGT
AAATTCTGGGCACATATAACCATCATGGTTATTAACTTCTTGAAGCCCAGTGATTTCAGA
AAGCACTAAAACTACCACCATCACTTAAAATCTCAAGGTTTTGAACATTCAGTGAAGATA
CTTGTTTTAGGAAACAAGTGGTTAGTTGGCCTGTTTGGAAATGAGAATACATGGGCCTTT
CAAAGGAGCTCACTCTGGATATTTATTTTAGATTGGAATTCCCCCAGCCCCTCGTGGAGT
GCCCCAGATTGAAGTTACATTTGACATTGATGCCAATGGGATTGTGCACGTTTCTGCCAA
AGATAAAGGCACTGGTCGTGAGCAACAGAGTAAGTAATCAGACTGTAAATGATCTGTCCA
GTTCCCCCCCCCCCCCCATCTTTTTTTTTCCCTAAGGATTGCTGCCTCTCTTAAACTTTT
TGGGAGGGGTGAATATTGTTTTGAGACAGGGTCTCGCTTTGTTTCCCTGGATGCCCTTAA
AAGTTGCTGGATAGGCAAGGCTGGCCTTAAACTCTGAGATCTGATTGCTTCTTCCTTCCA
AATGGTGGGATAGATGTCTGAATTTTTATATGTATAACATTAAGAGGGGGGTAAACAGGC
AAGCCTGACTTCGTGGATTGTTAAGTATGGATTGCTTAGAAGAAGATCACGTGAACCTTT
TTTTTAAAGAATTATTTATTTACTTTATGTATATGAGTACACTGTAGCTGACTTCAGACA
CAGCAGAAGAGGGCATCAAACTCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGG
GAATTGAACTCATGATGTCCAGAGGATCAGTCAGTGCTCTTAACCACTGAGCCATCTCTC
CAGCCCCACCCCACCCTCTCAAACTTTTTATACAATTTACTTACAAGGCTATGAGTATTT
ATAATCTGAATCATTCAGATTAATTACTATATAAATAGTGGTGGTCTGTAGCTATGGCTG
GCCTTGAACTCTGATCTGCCTGCTTTCTCAATGCTGTAATCAAAGGTGTGTACCTTCATA
CCTAGTGAAGTAATTTCTCAGTGCAGTAAGAGAACTAAAGAGCTGCCTTTTTTTTTTTTT
AACTACAGTTGTAATCCAGTCTTCTGGTGGATTAAGCAAAGATGATATTGAAAATATGGT
TAAAAATGCAGAGAAGTACGCTGAGGAAGACCGCAGGAAGAAGGTGATTACTTTTGCTGA
CAGTAGAGTTTGGTTACAGATACCCAGTCTCTCTCACCTCTCATCTCCTAATGGCTTTGT
TTAATGTGAGATTACACTATGTAGTCAGGGTGTTTGAGACAACCTCCCTAGTACCTGGGA
TCCAGGGCACATACTGGGTTTGGGATGATCTCTTTCGTCTTCCACTATCAAAATTTCCAT
GTCACAAAAGCCGGCTCAACTCTCAGACATGCCAAGTACTTCAGCTAAGAAACTGTGTGG
CAAGTAACTTCTCAATTGTTACTGAAGTTAATGAAACTTTGGTTGATTAACTTTTCTAAG
GAACGTGTTGAAGCAGTTAATATGGCTGAAGGAATTATTCATGACACAGAAACCAAGATG
GAAGAATTTAAGGACCAGTTGCCTGCTGATGAGGTAACAATTCACTGGTTCTTTGAAGCT
CATTTTTCTTGGGTTGGTAGTGATTCAGTTTCTTAAACATATGAATAAGGGTTGGAGGTG
GAGAGGCAAAAACCATTTAGAAATCTAAATAGTAGATGTAATAGTAAATCTAAATGTAAT
GAGACAAGATACCTAGATTAAAAAGATGTGTCTGTGTATCTGTGTGTTTTGCCGTTTCCA
GTGCAACAAGCTAAAGGAAGAGATTTCCAAAATGAGAGCGCTCCTTGCTGGAAAGGACAG
TGAGACAGGAGAGAACATCAGGCAGGCAGCATCTTCCCTACAGCAGGCGTCATTGAAACT
CTTCGAAATGGCGTACAAAAAGGTACAAGGGCTGGAGGGGTAACTGGGACCTAGTTATTG
GGGTTCCCTCTACCATTTATAGAATTGAGAAAACTGTAAATAGAATGTCACGGGGAAGAT
GAGGTTTGTACGGTGAATGAAGCCTGTTGAACAGAGAGCGAACTTGTGGATACCTGTGAA
ATCTTAGTGATCCTCAAGTATTTTCTCAACAGATGGCATCTGAACGGGAAGGTTCTGGAA
GTTCTGGCACTGGGGAACAGAAGGAAGATCAGAAGGAAGAGAAACAGTAATCGTGGCAGT
GCATTGTGGAGCCAGAAGGACATACTATGAAGCTTGGGACTAAAGGGACTTCCTGAGCAG
AAAAGGGGCAGACTTCAGTCTTTTTACTGTATTTTTGCAGTATTCTATATATAATTTCCT
TAATATATAAACTTAGTGACAATTGCTAACTCATTTAATGGGTAATAAAGTCAGCAATAG
CAGGTTCATACTGTTCTGTCACTAGCCTGTTATTTTCAGCTGCATGTAAAGGGGTGGGAT
GGGGCTGTGAACCAATCATTAAGGTAGATTTGGTTTGTGCTGAAATGGCTGTGATTTCAA
GGTGGGAAGCCCATTTCACATGCAGTGGAGGTAGTCTGTCATTGACCTTGAGTTGAGATC
ATATGCAGATGCTTGTTGGCCAAGAGCACTACTATAAAGAATGACCTCTGTATATTTGCT
CCTACAACTGATGCCTTTAAGACTGAGCTACCTGTACCATGGTCTGTAGGTGCAGAAGCT
AGGTCAGTGGATAGCAGTTGTGTTAGCCATAGCTTAAAGTATGATATGAGAATGATATAA
GCCTCTCATGGGCCTGAGGCATACTTCTCTAGCCACCCTCTTGGTTGGCCAATGTCTGGC
ATCTGTATTCTTGATGATTGTTCCTTTTTCATCCACTCTGGATTTTTTAAATAAAATTCT
GAAAGCCTCTTGATCTCCTTTGTGAATGGTGATAGCTCAAGGATTATGACTGCTATCAGT
TTTGTAGGGAGAAAAATCACTGGCTAAAAGGTTGAACAAATGAAACATGGGGAGTGACTA
ATAAAATGCTGGCATATATGCTGGATGTGAAAGTCCACTCAGGAAGCAGTTTGAAGCCAG
GCAGGGCTGTACAGTTAGACTCTGTCTTAATAAAAGTACTGGCATAAACAAATCCAGTCG
TTGTAATCTTCTATCTAGAAAAACTTCAGTGCTTTTTACCTTGAACAAATTTCAAGCAGA
GTTGGTTTAAAGAATATAGTTTCATTAGTAAGTTCTAATGTCTGATTTCAGTGACTCGGG
ACAGTTTTTGGGTGTTTTGTTTTTTGGCCTATGTCTATGTGCTTATCTCCTGAAGCTGTA
GTTAGAGGTAACTGTGAGCCCTGGTGGTGGCCCTGCATTTGCTGAGATAGGGTTTCACTG
TAGAATACTGGAATGTACTACAAAGCCACCTGATTTCTAAACATTTTTGAAACATTAGGA
TAGGGTTTCCAAGATACAAAAATAGGATATACAGCTATTATTTGCTATAAGTAATTATTT
CATGTGGAAACAAATCGAAATTCAAACCTCAGATGAAGCAACAAATCTGTTTTCATGCTC
TGCTTGACCCTTTAGGTTGTTGGAAAGCGAAGTATTGTAAGGATTTTCCCCTTCTGGTTT
ATTTTATGTATGTCAGTACACTGTAGCTCTACAGATAGATGGTTGTGAGCTTTCATGTGG
TTGTTGGGAATTGAATTTTTAGGACCTCTGCTCACTCCGGTCAACTCCGCTCACTCAGTT
CCTGCTTGCTTTGGCCCAAAGGTTTATTATATAATAAGCACACTGTAGCTGACTTCAGAC
ACCCCAGAAGAGGGCGTCAGATCTCAGTACAGGTGGTTATGAGCCACCATGTGGTTGCTG
AGATTTGAACTCAGGACCTTAGAGCAGTCAGTGCTCTTATCTGCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1175, 2610..2668, 2862..2949, 3940..4121, 6204..6328, 7166..7239, 7328..7434, 8687..8849, 9309..9401, 12060..12269, 13253..13480, 14401..14505, 15031..15148, 15908..16002, 16320..16412, 16621..16761, 16952..17706
1095..1175, 2610..2668, 2862..2949, 3940..4121, 6204..6328, 7166..7239, 7328..7434, 8687..8849, 9309..9401, 12060..12269, 13253..13480, 14401..14505, 15031..15148, 15908..16002, 16320..16412, 16621..16761, 16952..17026
NM_010481.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved