Mus_musculus Locus Mono:91:SNORD87
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:91:SNORD87
Mus_musculus
Mono:91:SNORD87
1
SNORD87
1001..1087
2087
GCTTGTATTCATGGATCAACCCTGTAAGTACGATCTAAAGTTGGAGCAAAATTTTCAAA
CTATTTGAAAGCCACGCAGGGTGGGGATGCTGGCAAAAGAAGGTGGTGGTAAGTTCTGAA
GCGTGTGGATACAAAAGAACACTACATTTCAGGCCTGCATGTTATACTTTACTGTTGGTA
TCTGTAAGCCAAATTGGGTACTCTGGATTTCTGTAAACTCAGCGTTTCAAATATGAAAAT
GATTAAGGATTTCTCATCGGTTTGCAGGTGATAAGTCATCACCAGTAATCGGTTCAATCA
TTCATTCTCTGATTTGTGACTCTGGCCATGCCGTTTCCTGTTCTAATGTCCCAGTGATGG
TCTGCACAATTGCATATATGCCTCAAGCTTTTCCGTGCAAGCACCAAGACTGAGAAGCCA
AGGCTTGGTACTCAGTCCTTTAAGTTAGTACTGGCAGTGAAGGGCGTGAGTAAAATGTTT
TTCTGTCTGTGATGGACGGATGATGGGACAGGAACTGAAGCACCACAGGAACCTGGAGTT
AGCGGATGCCGAAGCCATGGAGGATGCTATTAGCTTACGCTTTGGTTCTTAGAGAACACA
GGGCCTCCAGCCCAGGGGAGGTGGCTGCCCCCTTACCCCAGTCACTGATTATGAAAATGC
CTTACAGGCGTGCTTGTCCACAGCCCTATCTTAAGGATGCATTTTTACAATTGTAGCTTC
CTACACCAGTGATTAGCTTGTGTCAAGGTGACATAAAAGTAGCCAGTGCACACTCATGCA
AGGTATTAAAACATGGAAGTAAAATGAGAGTTCACAAATATTTTAATTTTTAGGTGCAAC
AAAACCTGCTCATTTGAAGGTGCTTGAACAAATATTTTCTAAACACTTGTCATGGAGAGT
GATTGAAACAAGCTGCCAGGACTACATTTGCCAATAACAAGGTACAAATTGTGTGTGTGG
TTTTTTTTTTTCTTTGAGGTTTGATTAACAGGGCCTTAATAGCTGGCACAATGATGACTT
AAGTTTTTGCCGTTTACCCAGCTGAGTGTTTCTTTGAAGAGAGAATCTTAAAAGACTGAG
ATGCCAGCAGTATATAGATGATGCAAATGACTAACATGTGACGCCATTGTTAAAATGGGT
TACTGTTTGTTCTCCCCAGCATGTAGGTGGCTGTAGTGGATGTCCAACTTTGGGAGCTGT
GATGTCTAAAAACCCTTTATTGTTTTGGGTAAGTTTGCTTAATCAGTCATGTATCTGGAT
TCAATACTGTTTGATAACACTGAGGGGCTGGGGCCAGTTCGTTTTGAAGATCATTAGGGT
GAACACCTGGGCCTAGTTTGAGATGGAAGAAAAATGATTTGGGGTTTCTGACTTTTTTTT
TTTCCTTTTGGGAAGGTGCAGCTTACATATTGGAAGGTAAAATGAAGGCCATGAACAAAG
TCAAGAAGCCATAAACAGAAGCAAATGGTGAAAATTAATATCTAATTTAATATTAATAAG
TTATATATAAATAAACAGTTATTCTTAATTGCTGTGGGCAGTAATTTCTTTAAAATGTCA
TTCTCGTAGTAAAATAAACTCGTCTTTCATGAGCTGCGGACTTTTTGTCAATGCAATCCT
GATGGCTGGCTAGTAAGTAGCCAGTAATGCACAGCAGGAAAGAAAGTGATTGGCAATCTG
TCTAGGATCACTTGAAACTCTCAAACTGGATTTCCTCGAGTGAAGACTTGGCTAAATCTT
TAACCAATAGAATCCCTAAGTTTAGTAAGTAGCTTAAAAATTCAACATTCTGATGACTTG
GGCCTTTGTAAGGGCTGGGGAAGTTTAACTGGCTTAACAAGGCACAAAGCTCTGGATTTG
ATTCCCAGGATAGAAATTTCGAACATTAGGCTTTCCAGGTGTGTTGGCTGTTTAGATAAG
AATTGTTTTGTTTTTACCCTAGAGACCTAGACTTAACCACATCATATGAAAAGGCACAAG
GCAAGTCTTGTTTGTATGTACTATATCATTAACTTGCTGTTCAGATCAAGTACCAAAATA
CAAGGTGCTGTGGGACCCTGTAGTACCTACCACCTCCTGGCAGGAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved