Mus_musculus Locus Poly:8:SNORD25
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:8:SNORD25
Mus_musculus
Poly:8:SNORD25
19
SNORD25, SNORD26, SNORD27, SNORD28, SNORD29, SNORD30, SNORD31, SNORD22
1001..1072, 1259..1333, 1542..1608, 1876..1951, 2100..2164, 2349..2417, 2602..2668, 2874..2999
3999
CCGCTGCGCTGACAACCTGGACATCAAGCCCCGTCTGCGCGCTGGGCGGCTGGCGGGGA
ACCGAGACACCGTCGGTGGAGTGTTCAGTAGGTTCAGGATCCATAGAGATGGATCAACAC
GCGGCTTAGCGTGAGTGAGGGTGAGAAATCGCCTCAACGTATGGATATTGGTAGTTGTGA
CCCAGACAGTCGAGCTGTATGGGTCGCGAACCAAAATCTCCAGCGATGACGTTTTACCCG
CAGTGAGTAAGAACCGCCTAGCCGCAGCGCCAAAGGCGTAGCGTCGCACTCCCCTAAAGC
GCCTGCGCCTCTTTTTCGCGCTGCAAAATCAGAGGCGGAGCTCTCCGCACGCCCCTTTGG
GCGGATTCCTCTACCCACAATTCCTCCGGCTCGCACACCGCTTACCTTAGCGCCTGCGTG
AGTCCTAGTCCCACCTCCAAATCCCGTGGGCCTTTGCGAGATGCTATTTATAGGCCACAC
GTTGTTCTTGTCGGCCTCATTTTTCCTTGTTCGGGGTAAGTACTCTACGTCTTTATGTGC
TGTAGTTTTCACTTTGTTTTTTTCTTGTCTTTCTCTTTTTTTTTTTTTTTTTGGTTTTTC
GAGACAGGGTTTCTCTGTATAGTCCTGGCTGTCCTGCTGAAACTCACTTTATAGACCAGG
GTGGCCTCGAACTAAAATCCGCCTGCCTCTGCCACCCGAGTGCTGCGATTAAAGTCGTGC
GCCACCACGCCTGGCTCTTGTCTTTCTCTTAATCAGCTTTCCTATAACTGCGGCTGGCTT
TTATCACAAACACCTATCTGTCACTGTTGTGAACCGCCGCCTGTATTTTCTTACGTAATG
TTTATTTCTGGTGATTTAAAAGACCCTCGTGGGCAGCGTTAATAAATGTGGACTTTGGTA
ATCTGTTCCGTAGTCTTAGCGGGGAGACCATGTTAGGGCATTCAAGACCTAAAGATGACA
GGATTTTGTGAAGGACAAAATGGTGGCGGCAGTGCAAGGCCACCCCCTATGATGAGGACC
TTTTCACAGACCTGTACTGATATATCTGTGAGGATAAGTAACTCTGAGGAGGCTGGCCCT
ACATCACAGCCTTCTCATCCTTTAGAGATTTCTTGGTGTAGAAGTAACCCGATGCTAACT
TCTCTACAGGTTTGAGGTGCCACCTTACAAAAGGATGGGTGTACGCTCTCTTTTCAGAGT
AAGTAGTGTTAATGGTTTTACCAGATTTTTTTGGTTGTTGAGTATAAGTTGTGTGTGTGC
TACGGGGATGATATGAAAACTGAACTCTCTCTTTCTGATGGTTTAGTGGAGAAAACAAAA
ATTCTCTGAGTAGCACAATCTGTGGCAGGTATTTGGATTGTTTGGCATAAAGTCTTTTAT
TGAAGTTTGGGGTTTTTTTTTTCTGTTCTAGATGTGGTTCATCTCAAAGCCCTTTACACT
TTGGAGCCAGGCCTGTTCAATTTTACAAATAACACGTTTTGCTTGTAGTCAGGTAGGTAT
TGATGGTTGGTGCTTCCTTAGGGAACATATTTAGATGGCCACTTAATGATGAACAATGTA
AATGACAAGCATATGGCTGAGTTGCAATGATGTCATCTTACTACTGAAATGGGCTGAAGA
AAGAAGGTGCTGAGGTGGCTGTGATTACATTTAAAAATGACATTGTTTCTCTGTTTCCAG
GGTGCTGTGACAACATGAAGAGTTCGAGCTACCTCCCAGGATGAGTGCAGGTAATTGTCC
AAGTAGAGCTTAGGGTTTCCCTAGGGAAAATAGTCAAGACAGACATTGAAGCAGCACAAC
ACTTTTTTGCTGCTTACTATTTGTATTTCTAGAGGACACATTATGTTAAGGCCTTTGTTC
TCTTAAAAACTCAACTGTCAGATGATTTGAAATGATGACACTGAACACTCCGTGAAGGTG
TGAATTTATAGCATGTTAGAGTTCTGATGGCAGTTAGTGCTGACAGACAGATTGTAATTC
TGTCCTGATGGTTGAAAATAACTACTTGTTACTCTTCCACAGGTTTTCCTGGTGACAAAT
CTCAGGCATTCAAAGGTTAGTTAGATTATTTTGGATGGGGTTTGTTCACTAGGTTTGCTG
TTTCTATGATGAATCAAACTAGCTCACTATGACTGCTAATGAAAACACAGGAACACCTGA
GAAACCAAAGGGTAGTGTGGGGGCAAGGGCCTTATATCCAGCCTTTTCAAGGTTTGTTAT
TTTTCTCCAGGTTCTGTTAGCAGTGCCATACTTGTGGGTTTACAGGTGAGTGATTCCAGT
GTGTGGTGTGGTGTATGTGCATAGCATTGGACTGGGGTGGGGGGACCTAACTGAGAACGT
ACTTTGTGTATATATGATGACTTTCATAGAATCTCGTTCGGCTGATGATTGCTGTTGAGA
CTTGGAAATCTGATTTTTCTCAGAATGATGGGTTAGATAGGAACAAGCTGTTGCAGGATT
TTTAACATTGCTGATGACTGTCTTGTTTTTCAGAGATGGTGTGTCTGGCTGAGAACAAAG
GAGCCGTACCAGGTATATGTCTTAGTAATGCTTTTTGTAGTATAAGGTTGAATATATAAT
ACTTAGACCTAGTGAATTCCTGCTCACCCTGATGAACTGAATACCGCCCCAGTCTGATAG
CTGTGGAGAAAGGTATTTTCTGAGTTGTGAGCTCATTTTGGATCAAGTAGGAAATTTTTT
ATGCTAATACTAGCATAGTATTAATACTAGCATAAGCTTTTGTAAAAGAAGCTTAAGCAT
TAATGGCCCAAATTGTTTGCTATTTTGTAGGAAAGTTGAAGCATATCTTCATTTTCAAGT
CCAGGCTAAAATAAGGTGAGAAAACTTAGATGAAAAGTATGCTGAACTATAATTTCCCCA
TGAAGAAATGTTCACACGTCCTACTTCCTGTCCTAGCTCCAGAGCCTGAAAAGGTGAACC
CACTGGGGCTGGCTGGGGGAAAAGAGGAAACTTTGTTCCAGAAGGAACTGTCTGAGGGAT
CATTTTTGTGCGTAGAAAGGGAAGAATTCTCACTTGATTAAAGAGGAATCAAAAGGTGAT
TTACTTGTTTTACAGGTCTGAGGAAAAGAATGAGCTGCGTGTGAAGGATAGGTAAGCCCT
TCAAATCATTAAAATGGGCGGCGCAGGGTTGGGGGAAACTGGTTACCTAGACAGCCTATA
GTCTCTTCTGATAGTGAATGTAGGATGATTTTGCTTTCTACTCCTAATTCAAATTTTTAT
CTTGCAGGAACAGAAATCATGAAAGATCTGTTTGTCCAGGCCAGTGTTTCACCATAAGAG
ATCACTTTAAAATAAATGATGAAATAATTCTTTGCAATTGCAAATTTACCTTCCTTGCTT
ACCACATTGTTAACTGTAGGAGCTGATACCTGGTTCTTCCACTGTTAACTTGTACTCTGT
GTTTGTTCTAGCAATAAATGCTCTTTATGCTATTTATTGTGATGGCTTATTTGATTTGGG
TGGATCCTAAAAAGTCTTGGTTTCACTAAGGTAAAAACCCTCTACTTGGTGATTTCTTTA
GCAGGACTATTGAGTCTGGAGTAATGGCACCTGAGCTTTGTATCAGCAAGGCAGGAAATC
TGGCTAAGAATTCCCTAGGTCAATTATACTGTGATATGCAGAAATTGACTTACTAAGGGT
TCCTTTTATATAACAAAAGTTTCTGTGAAACTCATCCTGCAATTACCAAGAAACCCCCAT
TTCTTGCCAAGAGTAACTTTGAAGCTGACCATGGCCTGTTAAATGGTTTCCTGTGTGTGT
GTGTGTATATGCTATTTAATATGCCTTTGCTGGCATTACTGCAGACCATCTGACAGTGTC
TCCATTTTGGCTAGGAAAAGTATGAAAGGAGATGAAGCCCAGTCTATTAGTGTAGTTTAA
GCCATAGGGAAGGGAGTTGAGCTGGTGTACGGTAAGACAGGGAGTAGAAGTAGAGGAGGC
TGACCATGAGCATGTGGAGAGGGGGACTGGTAGTGAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved