Mus_musculus Locus Mono:42:SNORA36
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:42:SNORA36
Mus_musculus
Mono:42:SNORA36
6
SNORA36
1001..1115
2115
ATGTCCCCAGAGAAGGCTATAAGCTTAGTTTGGTGTGAGGATGGATTTCCATATGTCTC
TTTCCTGGAGACTGGGGCACTGAGACCAGAGTCTCAGCAGGTCTGGATGTCACCAATGAT
CACACTGCAGTATCCTAGCTGGGGCTGACTGACTGCCACAGTTAACATGCTCTCTCTTTT
GCAACAGGGTTCTGTCTGGGCAGCTCATCCGACACTTCCTCAGCACACCTTCCAGGGATT
GGAATTATCTTCCTGATTCTTCCCGAATCTTCGTAGTCTACATGGGAATGGCCAATAATG
GTGACGTTGGAAACCATGAAATCTTTAGAAGAAAAGGTATTGAAGCAAATAGCGAAGGAT
GGGTAACTCAGAAGATAACGGAGACACCAGCCTGAGTCTACTGTGGCATTCTGCCCCCTA
AATAGAGATGCAAGGATAATGTGAAGAGGGTTCTGAGCACAGGAAGGGAAATCAGAATTT
CCCTTTGCAACACCTTCCCTTCTTTCCCATCACCCTTGGGTTTTGAGTGCTGAGCTGAAG
TTTGTTTTGTCTTGCCTGTTGGCTCCATTGGGGAAAGAGGAAGGGGAGGGTTAGAGCCAG
AGTTAAAGAGGTCCCCTTCCTTTGTTTAAGATACAGGCGGAAGGACGCTGTGATGTGACA
AGTTGTGTCTTTAACACGTAAACAGGTTCTAGATTGTGCTTGCCCTTCCCCTCACCCCTG
CACATGCCAAACTCCATTGGCTCTCCTCCGTGCCACAGTGTCCTGTCCTTGGCCCTGGCA
CTCTACAACTGCATGGTGTCTGTCCTTATGTCTCAGGCTGCTCCTTTCCGGTCCCCTTTC
TGGTTCCTCCTACCCATCCTTTAGATGGTCTTTACCTTTGTATTTTTTCCCCCATGAATC
CTTTTTACTCATTTCTTTAATGATGCTTTTCACATCCAAGTTTCTAGACCAGAAAATGTT
GTCTGGACTTCAGATTCAAAAATTGCAGTTCCTCTCCAAAGTGCTGAGTGCAGTTCCGGG
CTGCTTCCATGTTCTGTTAATTAAACATTGAAATTGGCTGAGAGAGATGATTAAATGGAA
AGTGTTATTCTGTTCATATACTGATAGCTCACATATATACCTACATACACACATGCATGC
ATACATGCATACCTACATATATACAGGCATTCATACATACATGTATGCATACACACATGC
ATGCATAATACCTACCTACATATATACATGCATGCATATATACATGCATACATACATACA
TATGTACACTCAGAAGCCCATTAGCAGCTATGCCACATTGAGATGGTGAATGAAAGACAC
CCAGAGGCCTGCCAGCTTATTTGGCCTGTCCCACTGTGGGAACCACTAAAATGTGCATGC
AAGAGTGTGAAAAGACAAGAGAGAAAGGGACATAGAACAGTTTGAGTACTTTGTAGAGAG
GCAGAGCTGAAGATGCGAGGGTAGAGAGGAGTGGCTTATTGTGCATGGTCTGTCCTGCCA
TCTGAGGCTATGGTGGAGTCCCCGCCCATGCTTCCTCTGAGGACCATGTCTGTGTCCCTA
GTCATATGCAGCAGCAGGGGTTAGTGTCGATGTCCCTGGCTCATACTACCTCTTAAGACC
ATGCAGATGTCTGTGGCCTGGGCTGCTTTCTGGGACTATGTTGATATCCATGAAGGGCTG
TGCAGAGCTGGTCCCACCCCTCAATGGCTGAGGCGCCATGGAGTGCTAGCCCCACCTCTC
TGGGCAGTAGAGTTGGCCCTGGTGGTAGGAGAACAGATGAGCCAGCCTGGAGGGCATGGG
CTGGTCTGGGCACATATCTGCTATGAGGTGAGGAGGTGTGGGCTCAGAGAGATACCCCTG
CACCCCAACCTCCATTCCTAGCCACCTGCCCCATTCAAGAGAACTGGCTGCCTGGGTCAT
GAGGGTCACGAGGTGGGTTGGGAAGCTGGTCTCACCCTTCACCAGCTGCAGGACTTGGGA
GAGTGGGTCCTGCAACTTACCTGGGTGGCGCAGTAGCACTGGCTCTGATGGCTAGGGGCA
CAGGCGAGCCATCTAGAGGGTGTGAGAGCTGGAGAGCTGTCTCCACCCCTTGCCAGCTGT
GGCACTGGATGGGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved