Mus_musculus Locus Mono:362:SNORD81
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:362:SNORD81
Mus_musculus
Mono:362:SNORD81
3
SNORD81
1001..1077
2077
GGCACTTCTACAGCTGTCTATTTGGATGTAAGACCTGCTGAATAGGAGGGAAAACATGC
TTAGTACTGAAAACATAGCCAACCACAAGTATCTACTGATGACCTGGAGAAAAGATAGCA
TCTTCAACAGATGGTGCTGGTCAAACTGCACATGTACATGTGGAAAATTAAAATAGATAC
ATATCTATCATTGTGCACAAAATTCAATTCCAAATGGATCAAGGACCTCAGCATAAGACC
AGATACCTTGAAACTGAGGGAACAGAAAGTGGAGAATAGCTTTGAATTCATTGGCACAGG
AAAAGACTTTTGGAACAGGACACCAATAGCAAAGACACTAAGACCAATGGGAACTTATGA
CATTGAGAAGCTTCTATAGAGAATGCAACATCATTTAAAAGAAATGGAAGCCTACAGAAT
GGGGGAAAGTTTTATCAAGAGAACAAATTACACACTTTTAGTGATTGATAGGTTAGGTCC
CAGTTCATTGAGGATGGTACAGTCCCTGGGGAGTGAGCAAGCTAGTATGCAGCATCCTCC
ATAACCTCTCCATCAGCTCCTACCTCCAAGTTCCAGCCCTGCTTGAGTTCCTGCCCTGAC
TTCCTTCAAGGATGGACTATGATGTGGACGTGTAAGCCAAATAAACCCTTTCTTCCCCAA
CTTGCTTTTGGGCATCGTGTTTCATTATAGCAATAGTAATCCTAATGAGGATAGACGTTG
GTACCAATATGATGGGGGTGTATTTCTGTGACAGACCTGACCATGTTGTTTTGGGAAGGA
TTGTGAAAGGACTTTGGAACTTTAGGCTAGAAAAGTCATTGATTGTTGAGAACTCAGTGG
GCTGCTCTGTAGGCGCGGGGAAGACAAGAATGTTGAGAGCAGTGTAGACAATGTAGGCCT
GGCTTGTGAAGTTTCAGTGGGAAGCAGAGACATCCCCAGCCAATTTGTGTTGTTTGGGCA
CCTGGAGCTGAAGAATTAGCTGTGATTAGGACACATGTGACCAGGACACATGATGATCTC
ACCCCAACTTGGACTCTCTCACTGATTACTTGATGACAGTAAAAGACGTGATATTCTGTG
TTTAACAGTTACCATTTAAGTTAAAATTGTGGAAATGTGCCTAACAGCTACCTCTGTTGC
AGGTGCCTGGATGGAGGATTGAATAGAAAATGTGTCAGATTATACATTGTGCTCTCAAGA
ATTTTACCATTAAAGTGCATTGCATAACAAAACAAAACACAACACAACAAAACAAAACAA
GAGACCAGAGCCCTTAAGGTAAAAATCTTCGTTTTGCTGGGACAATGGATGATGGTCAGG
TGGGGCTAAAGAAAGAATTAGCTATGACTAAGAAATGAGCAGCATCACTGACATGAAGTC
TTCAAAGAAGTGTTTGCTAAGAGTTATCACATGGAAGCTTTATTCTAGAGATGGCCTAAG
TTGTACCTTGCTTTGGAAGCCAAACTTCATAATGGGTGAGAGTCTCCCAAGTGGTACTAG
TTTTGAAGGCACAACAGGTGAAAGTTCAGCCCAGTTGCCCCAAGAAAAGTCCCAGCAGTT
TTAGAGACGCCAGTACCATGGGAGAGCCACCAAGGACAGCATCAGCAGTGGAGGGAGCCA
ACTGGATCCTAGAAGACAAGCTGTGTGTGCTGTAGAGGACTGAGCTGGTTAAGTGACCCA
AATCCTTTGGAGGAGCCCAGACCGCAAGTGGATTGCAGACATTGAATATTGAGTTTATTG
AGTTAGTTACACAGTTGAGTTTTGTTCTGCTTTGAATTGATTGTAACTGTGTCCTGGTTC
TTCCCTCTTGAAGTAAGAAAATACTTAATTTATTCACTTTTTTTTTTATTTTACAGAGTC
CACAGTTGAGAGACTTTAAATTTTAAACAGGAAAATTTGGAGTTTAACAGAGAGTCTCGA
TTTTAAAAGAGACGGAATAGTTTTAAAAAGTAAAGACTGTAAGGCTTTTTAAGTTCGTGA
AATGTTTACTATTGTGATGTCTACATCAGTGTGTGGTAATAGGAATGAAAAAGAAAGGGA
GGGTAGCCTAACAGTGACGTGTTTGTGTGTCAAGTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved