Mus_musculus Locus Mono:330:SNORD50
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:330:SNORD50
Mus_musculus
Mono:330:SNORD50
9
SNORD50
1001..1072
2072
TGTGCTTCAGCAGCCCGAGAGAGTTGCACGGCTAAGCACTGCAATGGAAAGGCTCTGCG
GCATATATGAGCCTATTCTAGGGAGACATGTCATCTTTCATGAAGGTTCAGTGTCCTAGT
TCCCTTCCCCCAGGCAAAACGACACGGGAGCAGGTCAGGGTTGCTCTGGGTAAAAGCCTG
TGAGCCTAAGAGCTAATCCTGTACATGGCTCCTTTACCTACACACTGGGGATTTGACCTC
TATCTCCACTCTCATTAATATGGGTGGCCTATTTGCTCTTATTAAAAGGATAGGGGGAGA
TGTTGGGAGCCGCGCCCACATTCGCCGTTACAAGATGGCGCTGACAGCTGTGTTCTAAGT
GGTAAACAAATAATCTGCGCATGTGCCAAGGGTATCTTATGACTACTTGTGCTCTGCCTT
CCCCGTGACGTCAACTCGGCCGATGGGCTGCAGCCAATCAGGGAGTGACACGTCCGAGGC
GAAGGAGAATGCTCCTTAAGAGGGACGGGGTTTCGTTTTCTCTCTCTCTTGCTTCTTGCT
CTCTTGCTTCTCTCTCTCTTGCTTCTTGCTCTCTTGCTTCTTGCTCTCTTGCTTCTTGCT
CTCTTGCTTCTCTCTCTCTTGCTTCTTGCTCTCTTGCTTCTTGCTCTCTTGCTTCTTGCT
CTCTTGCTTCTTACACTCTTGCTCCTGAAGATGTAAGAAATAAAGCTTTGCCGCAGAAGA
TTCTGGTCTGTGGTGTTCTTCCTGGCCGGTCGTGAGAACGCGTCTAATAACAGAAGATGA
TGACCTGAAGACAGATACAGCTTCTGAGAGAAGACCATTGTGTTTAAGTGAAGTTTAAGT
CTTGTTTGTTACGCAGTCCTTTCTCATAGCATGTCATGGTACCTCTTTCTGCAATGAAAC
CTGACCAGTGAGATGCCAGCCTGCCTGTGAAGATCCTGCAGCAGGAGTGCATGTGAGTGG
TGCTCTGTTTTGTTTTCTGCTGAGCTTACTGTCGTTGGTCTAGTCTATGATGATCCTATC
CCGAACCTGAATTCCTGTTGAAAAACCATACTTACGGATCTGGCTTCTGAGATGGACCAT
TGCAAAGGACTGTTGTGTTCTTCTTTAATGTTGGCAGTAATGTGATGCCTGTTTTTTGTT
TGTTTGTTTGTTTGTTTTGTTTTGTTTTTATATTTTAGGACCTGTGACACTAGACTTCTT
GCAAATGAACACTAGATATGGTAACATCCAGAAAAGGCAGAGACAAGAAAATTCACAGTC
TGAGTACTGGGGTGTTTGAGATGGGGTCTATCTACATGTCTCTAGCTGTCCCTATGTAGT
GATCGGGACAGAATCTGGTATGGCCTGCAGAGTTGATTCCTGTATGTTTTTTTTGTGGGC
TGTATGTAAATGGATTGTTTTTGACAATCCATTTGACCATGTTCTCTGCTGTGACAGTCA
TGGGTGAGCTGGTGACAGACACACCTGTGCAGACTGAGCAGAGTGAATGCAATCCTGACT
ATAAAGCAGCAGGTCACTATTTTTGTGATTGTAAAATTGGTTATGAGCCATTTCCTTATT
CATCTGACAGTGGTTGCTTGGGAGTGCTGCAATAAGCATTCAGTAGCAAATATTTCTTCA
GGTTTTATTTTTAATGATGAAAAAATAAGTTTATTATAATTTATTTTATGTGACGATCTA
GGAAGTTTGGGCCCATCAGCAGTTCCAGTGCAATTTTGGACGCAATTGGGAATTCAGGAA
TTTCAATGGAGCTGTTAGCATAGGGGACCTTATAGGTCAAATTCATGCACACTTTCAATA
GCACGTGTGAGGGGATCTCTCTAAAATTGACCTCATTGGTTCCATTCTCCGCAAACTAAC
CTGGACTGCTCCACATGGCCTTTCTTGTTCCTGATGTTGATGCATGTTCTCCTTTTACAA
TAAATTCATGACCATTAGAAGACAATGATTTCACATACATAGCATCAGGGCCTTCACAGC
CGCTGTAGGCTTTCTCCACTCCATCCATTATGTTCTTATAAAATCCTGTTTGATCCCAGA
GGAACTTTAGTAGTTTCCTGTCCAGGCCTAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved