Mus_musculus Locus Mono:224:SNORD70
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:224:SNORD70
Mus_musculus
Mono:224:SNORD70
10
SNORD70
1001..1077
2077
AACTACATAGACTCTACTGCTGAAGACATCATACACTTCCACTGAAGACCATAGAGAAC
TCAATCGCAAGCTGACTGGGAAACTTCCTCCTTGTTGGATAACATTCACGATGCCAGGAG
TTACTATACATAATGATAAGGAGGCGAAAACACCAGAAAACCTTGCCAGTGATGGAGACA
CATGTTACAATATAGACTTGCCTTGCAGAGTATATCCTCTGTCTCAATAGTGAAGTGACT
GATATAGGGGTGACTAGTAACTTTCTGATTTGATTTAAAGCCTGCTCTACAGGACAGAAT
CTATGTATGCAACTATAAACCTGGTTAAAAACCCATGTCCCAGATTTCGCAGAAATTAAG
GGAAAATCTACTGTTGTTATTTCAATAAATTAACATGTTATCAAACTGCCTTCTAAATGA
TTGTTTATGTGCATAGGTCTATGCTTTTCTCGGTCTTTGTCGGAAAGACATCTTTTTTCT
TTGGTGGACAGCAGCTAATACAAAGTTGTGTAATTGGTCAAGGTGTTGACAATATATAAT
TGGGACCTTTCAGAAACAATTGGAACATCTTTATCATGCTACTACCTCTCCTAAGTTCAG
GAAGCATTGAGGAAGAGAGGACAGAATGAAGTGAAGAAGAAAACTGGGAAATGCTGTTGC
TAGATATTTCATGACTCTTGCAACCATGAAATCACATTAGTATGGGCATCTTAATAAGAC
CTGAAAACAGTCAGTCCCGGCAAAACTCCAATATGAAAGTGGAGGGGCTCACAAAGTTTT
ACACATATTTGAGGACCTATTGGCAGCTGATAGCTGTCAGGGTAGAGAGGGTCATTTTTC
TTTGGAAACCCAGCCATTGGCAGGTTTCCTGTATTTTCATAGATGATCCCACGCCCATGC
ATCAATGGATAAAAATAACTAAAATATATAAATTGAGATATACAAATAACTCAATAACAT
ATATATTTGCATATATAAATTTAAAGAAAGAGCAAACATGATTGTCAATGATTCATTTCT
TTTGGAACTGAATCTAGTGAATTTAGCAATTTTCCACTATCACTGAGGCAGAGAGAGAGA
TAGAAAGACAGAAACAGAGACAGAGACACAGAAAAGGCATGAAGTTGGAAAGATATGTGG
TAGGGTTCCAAGAAGAAGGAGGAGGAGAAAGAGGAGAAGAGATGTATCACACAAAAATGA
TCAAAATATGTTGTATACATGTTAAAATTTTCCATACCAGAGAAGTACATTAAATTTTTT
GAATTTAAGCCACCTTTGAATAAATGTATTTGTTAGTTATTTGTCACTTGTAATTTATAT
ATTAGTTACTGCCCTAAATTCTTTACACACAGTATATCACATCTCCCATCTTTACAACAT
CTAAGGATGAATTTAGCCATTACTGTGCACAAAATGAAACTAGTACAGTGGTAAACAGTG
TTTAAATTTGGAAAGACTAAGTAATTCCCAACTTTAGGCAAGATTAATCTTAGTTTTAGG
ATATACATGGAATATCAGAGACTCTGGCTATGTACATTTCTCCAAGTACCAGAATGAAGG
GGAAAGAGCAGAAGTTGGGACATCAAAATCTTACCCTTTGGTTATTTTCTATGGATATCC
TAATGAACATGACCAGGTAGTGGCATTCTAGTCTGCTTTCAATCTCAAGCTTCTAGTGCC
ATGGCCAGTGTACTGAAGAAACCTAAGCAGGTAGAGAATATAACCCAGTTTGGTTCCACA
TCATTACTTCTCAAGTAGAGCTCTTTGGCCCAACTAACTAATGTTTGATCTCATAAATAT
CACTGAATCTACAACATTACAAAAGAAAAGAAAACCTCAAAACTCCTATGACAAAATCTG
ACTAGTTCACGAGTTTACATGTTTGGAAGATGAATTTTTAGTGTGTGTGAGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACATGTGTAGATGTGTAGAGACAA
AGTTAAAGCAGGGATTGAGGGAACAGTCAAATAATAATTCAATGACTGGCACACCTTGAG
ACCTATCCCATGGGAGAGAGCCAACCCCTGACACTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved