Mus_musculus Locus Mono:318:SNORA20
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:318:SNORA20
Mus_musculus
Mono:318:SNORA20
9
SNORA20
1001..1113
2113
CAATAAAAAGGATGATAAATATATTGTGGTGACACATTACACGATTGTAATCCCAGCAC
TAAGAAGCTAAACATAAAGATCAAGAATTCAAGGGCAGCCACAACAAGGAAAAAAAAAAG
TGAACAAGACAACAGTAAAAGAAAAGATTAAGGAGACTTTACTAAGATTATAAATGTTCT
TAATAGGATTAAACATGGGGAAAATTATAGAGTTATCTGTAAAAATAACCACTAAAGTAA
AAGAGTACTAAACGAAAAAAATTGGCCAAAAGTCATTTAAAAGTTAATCTAAGGGATGGT
GAGATGGCTCAGTGGGTAAGAGCACCCGATTGTTCTTCCAAAGGTCCGGAGTTCAAATCC
CAGCATCCACATGGTGGCTCACAACCATCTCAACCATCTGTAACAAGATCTGACGCCCTC
TTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATCAATAAATAAATCTAAA
AAAAAAAAAAGTTAATCTAAGCTGGGTGTGGTGGCGGACGCCTTTAATCCCAGCACTCGG
GAGGCAGAGGCAGGGGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGCTCCA
GGTCAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAGTTAAT
CTAGTTATGTCCCAGACACTGTGGCATACTCTGGAGGTAGAAGCAAATGGCTCTCTTAGT
TCAAGGCCAGCCTGGTCTACATAGTAAGGTCCAGGACAGCCAGGGCTGCATAGTGAGATT
TTATCTCATAATCATCATCATCAATCATCATTTTCGTAATTGTCACCATCATTATTGTTC
ATTATTGTAATTTAGTTATAACAGTTACTTACAAGACCAATTTACACACACATACAAAAA
TCAATTCTGACTTAATTTTTATCACTAGAAATTCTTTCAGTATCTGGAGGCAGAGTCAGT
TTGACACAGCTGATTATACTTTTAAGAATAAAAGCTAAGAGTTTCCCATTAATTTGCTGT
TCTAGTCTGTCATAGCAGTTATACACATGGGATAATATTGGGCCATTGTACATAGAGAAG
TGTGTTTTGTCCCTCCTGCATGGTCCAGACATTGTTCTTGGTGCCTTATGTCTAAATGTC
TTATGAGTTGGATTTAATCAAGGTTTGCAGTTAATGTTTTCACTAATTAAAAATGCTAAG
AGCTTCACAAAAAGAATAAAAGCTAAGAGAACTTGGCTTGAGAACTGGGTGTGAGCACAG
TTTCACTGTGCGACTGCACTCCAGCCTTCTCACCTGAGGGAGCAGCGGGGTTGCTGGGGT
TCTCACTGGCAGATGCACACAGGTCCTCTTCTCCATCGGTGGAGGAGCTGGACGAGGAAT
CGCTGCTGAGGTCATTCTCACTGGAGCTACTGGAGCTGGAGAGAAGAGCATACTTCCTCT
GAGCTAGCGCCTCCCGCTTCTTCCTCTGCACTAGCATCCTCTCCTTCTGCTTCTGTGTCC
TCTGCGAGGAGCTGCTCTTCACCAGCCTCTTTCTGCATGTGACTCTCCTTAGTGCACTGC
CATGAAAACAAGGTCTTTTCATTAACAAACTTGGCACAGGATCTGCCTCAGTTCGAGGCC
ACTTGTGAGACCTTGCACTGTGACTTCTACTTTTAGCACTCAGAACAGGCTGGGTATGTC
TCACCGAGACTTCTTTATCCTCATCTGAAGTCACTGTATCAGAGCCCCCAAAATGGAGAC
TAGATGAGGGAGAAGACAGACACTCACTTAAGGAAGAGTCATTATCCTCATCACTCGGTG
TCTCTAGCTGTTGTCTGCGCCCTAGGATTTCCTGATTTTCTTTGACACAGTTCTGCACAT
ATGAGGGGCCAGCCTGCTGGCTTTTGCGCTTTTTTCTCACAACACCACTTTTTTCTTGTT
CTTGCTGGTTGCCAGTCATGTCCTTCTCTTGTTTTTGAGAATCATCACACAGATGAGAGA
ATTCATTCCCCACTTTGCTATTAATCATCTCCACTTCTGCAGGGAAGCTCTTGGTGGCCC
CTAGGGGCTGTGGGTGCAGAAGGACCGCCTTCAGACTCTCCTGTGTAGTGGGCGCATCAG
GAGTCCCACTCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved