Mus_musculus Locus Poly:7:SNORD78
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:7:SNORD78
Mus_musculus
Poly:7:SNORD78
1
SNORD78, SNORD79, snosnR60_Z15, SNORD47, SNORD81
1001..1066, 1378..1451, 1618..1698, 2099..2175, 2325..2400
3400
TCTGTGGCAAAGGAGGATGAAGGCTTACGAGGTGAGTACTGAATAGTAATGAGAAGTTA
GGTTGAAAGGACAGTGCCACAATGATGACATCATATTTGCTACTCTTGACAGCTGGGGTG
ACGATAGCTTTAAACCACCATGATTATAACTGAGGCACACAAAATAATGATTTGGGGGCT
ACTTACAGAGTAAGCAGTTTTTACATAAAGATTCCCCCCCCCCAGGACTCGTCAGGAAGC
TGGATAACAGAGCGAGCGCAATGTAAGCAATTTTGTGTGTGCATGTGGTCCCATTACAAG
GAATACCCAATGGCAAATGAGCACTAAAGATCCCTCAACCCACACATTGAATGTATTGTT
CCCTGAGAGCAATTGTAGATAGAGGAGTGGGTGGGAAGTCTGAAGTCAGGGCATTGTTTC
TGCGTATCTGAGGAGGCTGGTTTTTGATATGTGGGAGCTAGTGGTCGTTAACGCATTTAC
CCCCTATTTGGTGGACTCTGGTTCCCCCATCTTAAGTGCTGAGTCAGGGGCCTAACCGGG
CAGCTTTAACTATTTGTTTGTTGTAGGTGCTAGAATAGAAGACCAGAAAATGAAATGGTA
AGTCAAACTAAAGGAATTGTAGATGCTAAACAGGCTTGGCTTTGTTGCACTCTGCCAAAT
ACTGGCCACGTGTTCCATCCTGGTCATAGCTGAACACAGCCTGCATGATGACGAACAAAT
ACTGACTACCTGAAGATCTTATTAGCTCTATCTGATGGTGGGCTTCCTTGACATTTATTG
TGGGGCAAACTCAAATCTGTTGACTGCATTGAAAAGCTCTTTAATGTTTTTTTCTAGGTG
GAGTTTGAGGCTGGATAGACAGTTTGAAAGGTAAGTATTGAAAAACACTTGAATTTGGGT
CAGTACAAAGGGACATGCAGAGACTTTGAATCATCAAAACTCCAGCATGCATTGTCTTAC
GGATGTTTAGATAGGTGTGTTTTGGACAACACTCTGGGTTCTTGTAATGATGTTGATCAA
ATGTCTGAGCTGAAAATAACTTGTAGACAATTTTTAACACTGAAGAACCTTGTGGCAGGC
AACTAAGAATAGTCGAATGATGTTTAGCATATTTGTAAGAGGTATTTTCTTTTAATTCTA
GTTAACTGGTTGCATGCTTGTTCATTTGGCTGGCTTGCTTGGGTAAGAAGCCATTGGGGG
CCTTGAATTCCCTCCAGTCATTTGCAGTATTTACTGCATAACATTTAGCTTTTGAACATG
CATGTGCTACCATCAGTACTAAATGGTGCCTTAAATTTTTTTCAGGTACAAATAATGGTT
TGAATAAAGAAAGGTAAGCATTGTAAGTTTGGTATTTACTATATGAATTAAGGTACTGTT
AGTGATGATCAATAAAGTTAAACAGATGGGAATCTCTCTGAATAAGATTGAAGATTGATT
GTTAAGCTGAAACAGTATTTAAGGACATCAGTAAATATACTTTACAAATACATATTTCTA
AACGGAGTGTAATTTCTTACAGGTATTAATGGGTCACCTCAAGTGAAGGCACTGCAAACA
CAATGGTAAGTCTTTGAAATGTGCATGTATTAGTTACTTTCAACCCCTTCCAAACAAGCC
GATACCATGATGATAACATAGTTCAGCAGACTTAACTCTGATGAACAATCATGTCTTTCG
CTCCTATCTGATGTATCTGGCTGTAATGTTTTAAAGAGTTTTCCTTGAATAGTATTAGGA
AATACAAGATAAGAGTCCCAAGTGATGAGGCCAAAGCCTGATGCTAAGGTGGCATGTGCT
GTGCCACTGACTTAACCCAGTAGGACAATTTTATTGTGAAAAATACATAAGTTCCCTAGG
GTATGACGATTGAAACTATAAATCTCAGGCCTCTTGGCAAGAGAATTGATGTGAGCCCAT
GGAGACTAGTGAAGACAACTGAACACTGAGAGAATAGTGTGAAATAAAATGAAGATAAGT
AACTGCACTAATTATTTTTAATTTTCAAACAGATTGGTCATTCTGAATTTCCGGTCCTTC
ATTCTGAATTTCAAAGTAAGTCTGTCACTTGTTTTTGTACAGATTGTAATATAGCTTGTA
ACCAGTGATGTGATGATTCTGCCAAATGATACAAAGTGATATCACCTTTAAACCGTTCCA
TTTTATTTCTGAGGTTACTATACTAACATGTAAAATTTAACTACTCTAAGCCAGAGAAGT
AAGTCAGTCTTTGTTTTCTTAGGGCTCCTGTGACAAGTGGACATGCAGTGACTGCACCTT
TGTTTCTGAGGTGAGAACTGCAAATGCTTAACCGGGAACCTACTCCAGAATACATGATGA
TCTCACACAACTTGAACTCTCTCACTGATTACTTGATGATAGTAAAAGATCTGATGTTCT
GTGTTTTAACAGTTACCATTTAAGTTAAAATTGTAGAAAAGTGTTTAACAGCTACCTTCT
GTTGGTTGTTGCAGGTGCCTGGATGGAGGCTCAAATAGAAGATGGTGTCAGATATATTGT
GTTAAAATTTTACCATTAAAGTGTATTATAACATGAACTGTGAAGTGTGCATTTTGTTCT
GATGAGCACATTGTGGGGAGTTCACATTAGACATTTTTAAATCTATTAGCTGCCCAGTGA
CTGGATGGTATTGGTGTCAGTATAGTTTGTCTTTTTGTGCTTATAAGCACAAGCCATTAT
TTTTTTTTAAGATTTTTTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACT
CCAGAAGAGGGCATCAGATCTTGTTACAAATGGTTGTGAGCCACCATGTGGTTGCTGGGA
TTTGAACTCTGGACCTTCGGAAGAGCAGTTAGTACATCTCTCCAGCCCTAGAACACTTTT
CTTATATCTTATAAAACTAAATATTTCATGGAGTATGCAAAGGGGAGTACAGTCACAAAT
CAGTTTGCCTGGAAATAGTTTTTTTTTCTCTTTCCTTTCTCAACACAATCTAAGATGAAC
CAAAAGAGAAGTGTGCTCTTACACACTGAGCCATCTCACCAGCCTCAAGCCATTATTCTG
TTTGACATTTTAAATTAATAGGAACAGCGTTAACCAGAACTGGACTGACTGGTGGAGGTG
GTATTTTCACTTTTGGCAGGTGACAGTGTCTGCTGAGTCTTACATCCTGAATGTCTAATC
AGTTATGCAGTCTGAGTGGGTATACCAGCCCTTTAAAGGTCTGGAGATGGCCTGTAGGGG
CACAGGTGTGAGGGAAAATTTGAAGTATAAACCTGGAAGGTAAAAGCCTAGACCTTGCAG
TCCTGTTAAAGTGTTGTCCCCATGCCTAGGACTTTTGCAGTTATATATACCACCAGGCCT
AACTCAGCATTCCTAAATTAGGAGGAACACTGAGGCTAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved