Mus_musculus Locus Mono:102:SNORA7
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:102:SNORA7
Mus_musculus
Mono:102:SNORA7
1
SNORA7
1001..1122
2122
CATATATGGAAAGGAGAAGAGGGAAACGGAGAGAGACTGGGCCTGGCATCGGCTTTTGA
AGCCTCAAAGCCTGCCATCTCCAGTGACACACTTCCTTTAACAAGGCCACGCCCACTCCA
AAGGGCATGCCTCAGAATGCTGGTAATCCTTTCAAACAGTTCCAAACTGTTTGAAAATCT
TTTTAAATTTTCTGCTAACCAAGCATTCATGTATAGGAACCTATGGAGTCCATTCTTTTT
CCAATCGTCACACTATCATGGTCAAGGTCATACTTTGGTATTTTCCTTGGGACATAGTCA
ATCAAGGGACTTACTAGAAACAGAGATATGTTATAGCTGAGTGTATTGAACATACATTGA
TTTTGAGATCCCATATGGCAGACATATGATTTTAAATGTGTGTATGTATACACATACACA
CAAATATATAATTTTATATTATATATTACTAAATATAATATATGACTGTCTTAATTAGGG
TTTTACTATTGTGAACAGACATCACCACCAAGGCAAGTCTTATAAAGGACATCATTTAAT
TGGAGCTGGCTTACAGGTTTAGAAGTTCAGTCTATTATCATCAAGGTGGGAGTATAGCAG
CATCTAGACAGGCATGGTGCAGGAGGAGCTAAGAATTCTACATTTTCATCTGAAGGCTGC
TAGTGGAAGACTGGCTTTCAGGAAGCTAGGAGGAAGGTCTTAAAGCCCATGCCCACAGTG
ACACACCTACTCCAAGGCCACACCTCCAAATAGTGCCACTCTCTGAGCCAAACATATTCA
AACCACTACAATGATATAATGTATCATGTACAATGTATAATATATATTATTAATATAATA
TTATATATGATAAATACATAGCATGTAACAAAATATATAATAAATATATAATTATGATAT
CATGTATAATATATAACAATCTAATTGTAGGAGTGATAAACTCAAGTTCAGAAAACATAT
ATCCTGTGACTAAACAGTATGATATTGATAAAAAAATATGTAAATTACTAGTATTCTGTC
AGCTTCGGAAGCAGGAGGGAGAACAAGTCTAGCAGAGGGACCCACTCCACTCCCAGTTTG
CTCTGCTCGGTAGCTGGTGATTGGAAGACACTCTGCAACATCACTTAAGGCCTGAGACAT
GCAGCCCCACCTTCCAGTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTTCTTTCTTTCTTCATTTCTTTCTTTTTTTTTTTTTGTTTGTTTGT
TTTTTTTTGTTTTTGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAA
CTCACTTTGTAGACCAGGCTGGCCTCCAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAG
TACTGGGCCAGTTTCTTTACTAACATGGGTCTGACTTCTGTAAAAGGCATCATGGCTGCC
CTCCGGCCTCTGGTGAAGCCCAAGATCGTCAAAAAGAGGACCTAGAAGTTCAGCAGGCAC
CAGTCAGACCGATATGTGAAATCAGTGAAAGCAGAACTGGAATAAACCCAGAGGCATTGA
CAACAGGGTGCAGGGAAGGTTCAAGGGGCAGATCCTGATGCCCAACATTGGTTACTGGAG
CACCAAGAAAACCAAGCACACGCTGCCTAGTGGCTTCCGGAAGTTTCTGGTCCACAAAGT
CAAGGAGCTGGAAGTGTTGCTGATGTGTAATAAATTTTACGGTGCTGAAGAGGCTCACAG
TGTGTCCTCTAAGAACCGAGAAGCCATCGCTGAAAGAGCAGCATAGCTGGCCATCAGAGC
CACCAATCCCAACGCCAGGCTACACAGCAAAGAAAATGAATAAATGGCTTGTGTGTATGT
TTTGTATTTAAATAAAAACCACAAAAACTGCCAAAAAAATTTGTATAAATTAATTTCAGA
TAGTAAGAAAATTTTGTTTCTGTCTTCTCTTTTCTTTTTCTTTTCTCTCTTTTTTTTGTT
TTGTTTTTTTTTTTTTTGAGATGAAAAGAAAGGGAAATTAGTCTAATCTGTGGCCTATCC
ATGCAAATCAGATCACTGTTTAATTTAAATATTGCCTCATCTATGTTCCTTTAGGCAGAG
TAGTTCTCTATATAATTCATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved