Mus_musculus Locus Mono:384:SNORA9
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:384:SNORA9
Mus_musculus
Mono:384:SNORA9
17
SNORA9
1001..1134
2134
CTCCTGGGCATATATCCAGAAGATGTTCCAACTGGTAATAAGAACACATGCTCCACTAT
GTTCTTAGCAGCCTTATTTATAATAGCTAGAAGCTGGAAAGAACCCAGATGTCCCTCAAC
AGAGGAATGGATACAGAAAACGTGGTACATTTAAACAATGGAGTACTACTCAGCTATTAA
AAAGAATGATTTTATGAAATTCTTAGGCAAATGGATGGATCTGGAGGATATCATCCTGAG
TGATGTAACCCAATCACAAAAGAACTCACATGATATGCACTTACTGATAAGTGGATATTA
GCCCAGAAACTTAGAATACCCAAGATACAGTTTGCAAAACACATGAAACTCAAGAAGAGC
GAAGACCAAAGTTTGGACACTTTGCCCCTTCTTAGAATTGGGAACAAAACACCCATGGAA
GGAGTAACAGAGACAAAGTTTGGAGCTGAGACAAAGGATGGACCATCCAGAGACTGCCCC
ACCTGGGGGTCCATCCCATAATCAGCCACCAAACTCGGACACTATTGCATAAGCCAGCAA
GATTTTGCTGAAAGGAGCCTGATATAGCTGTCTCTTGTGAGGCTATGCCAGTGCCTGGCA
AACACAGAAGTGGATGCTCACAGTCATCTATAGGATGGAACACAGGGTCCCCAATGGAGA
AGCTAGAGAAAGCACCCAAGGAACTGAAGGTGTCTGCAACCCTATAGGTGGAACAACAAT
ATGAACTAACCAGTACCCCCAGAGCTCCTGTCTCTAGCTGCATATGTAGCAGAAGATGGC
CTAGAAGATATGTATAATGCCCGGGCAATGACAATAGATATTTGTGGAAAGTGTTTAGTA
TTAAAAAGAATATAATAGTGAATGTATACTGTGCATTTGTCATGTGTAAAGCACTGTCCT
AAATGCTTATATATTTAACCTTTTAATATATTTGATTCATGTGATAATACTAGAGTGATC
TATTAATGTTATTGTATTTTTTATTAAGAATAAAGTTTTCCTAGCAAGCCACCAGCATGC
TTGGGTCTGCAGTGACCCTGTGCATCCCTAAAGTGCTTGCCAGAACAATTTTGAAGTTGG
TTTGAGGCCTTGCCCTGGTCTTTCCAGGGCAAGGTTATAGAAATTTCAGACAATATGGCA
GACACTTGCCACGTGGATAAATTACAAGCCGTCTAGGAAACCTAAGGTGCTGGAGCTAGA
AGAGACTTGATGGCACTTCAGAGACCATCAGGCTGTTTTGTGGAACTTCCACCAAAGAGA
TACAGAAATGGAGACTAAGAAATGAGACTCCAGGGCTGCAGAGATAGATGGCTCAGTGGT
TAAGAGTACTGACTGCTCTTCCAGAGGTCCTGAGTTCAGATCCTAGCATCCACATGGTGG
CTCACAATTATCTGTAATGAGGATCTAATGCCCTCTTCTGGTGTGTCTGAAGACGGCGAT
GGTGTACTGACACACATGAAACAAATAAGTAAATAAAAAAAATAATAAAGTTTTCCACAG
AGTATATTCAGATCAGTTTCCCCTCCCCCATCTCCCGCCAGATCCTTCCCACCTCCTCAC
TCATCCAACTCCATCCTTCTCCCTCTATTTAGTAAAAAAACAGGCACTAAAACAAATCAA
CAAACCAGAATAAAAAAGAAAGCCAGCAACAAAGAAAAAGCATAACATCAGACAGACAGA
TACACAGGCAGACAGACATAAACCCCATAAAAACATAAAATCAGAAACCGTAAGCTACAA
GCAAAAGATCAGTGATATTAAAAACAAACAAACAAACAAACAAACAAACCAAAACCCAAA
ACCAACCAAAACAGTATAGGACACCCTCTCACCCTCTTGCCCCATCTGTCCCCTCCCATC
CCCCCACCCTGAACTTTCCTGTTTTGAACACTGAATTTTCCTGTGTTGGCCATCTACTAT
GAGGCAGGGCTCTTAAGTGTGGTTTATATACCCGGTGAGACTTGATTGGAGAAAATTAGT
TTTTCCTTTGGAAATGGTTGTGAATTGGAGATAGGCTCTTGTTAGGGGTGTGAGTTCACT
TATGCTTTCTCCCATCATCACTGTGACCTCCTCTGGCTTGAAACTGTGCAGTCCTCTGAG
TTCATATCAACATCTTGTTGTGTCTGGAAAACACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved